Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RCAN1-regulator of calcineurin 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RCAN1-regulator of calcineurin 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002864 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RCAN1 |
| Origin species: | Human |
| Product name: | RCAN1-regulator of calcineurin 1 Gene |
| Size: | 2ug |
| Accessions: | BC002864 |
| Gene id: | 1827 |
| Gene description: | regulator of calcineurin 1 |
| Synonyms: | ADAPT78; CSP1; DSC1; DSCR1; MCIP1; RCN1; calcipressin-1; Down syndrome candidate region 1; Down syndrome critical region gene 1; calcium and oxidant-inducible mRNA; modulatory calcineurin-interacting protein 1; myocyte-enriched calcineurin-interacting protein 1; near DSCR proline-rich protein; regulator of calcineurin 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggaggtggacctgcaggacctgcccagcgccaccatcgcctgtcacctggacccgcgcgtgttcgtggacggcctgtgccgggccaaatttgagtccctctttaggacgtatgacaaggacatcacctttcagtattttaagagcttcaaacgagtcagaataaacttcagcaaccccttctccgcagcagatgccaggctccagctgcataagactgagtttctgggaaaggaaatgaagttatattttgctcagaccttacacataggaagctcacacctggctccgccaaatccagacaagcagtttctgatctcccctcccgcctctccgccagtgggatggaaacaagtggaagatgcgaccccagtcataaactatgatctcttatatgccatctccaagctggggccaggggaaaagtatgaattgcacgcagcgactgacaccactcccagcgtggtggtccatgtatgtgagagtgatcaagagaaggaggaagaagaggaaatggaaagaatgaggagacctaagccaaaaattatccagaccaggaggccggagtacacgccgatccacctcagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear RNA export factor 1 - nuclear RNA export factor 2 - SECIS binding protein 2 - collagen, type I, alpha 1 |