BIRC5-baculoviral IAP repeat-containing 5 Gene View larger

BIRC5-baculoviral IAP repeat-containing 5 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BIRC5-baculoviral IAP repeat-containing 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BIRC5-baculoviral IAP repeat-containing 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008718
Product type: DNA & cDNA
Ncbi symbol: BIRC5
Origin species: Human
Product name: BIRC5-baculoviral IAP repeat-containing 5 Gene
Size: 2ug
Accessions: BC008718
Gene id: 332
Gene description: baculoviral IAP repeat-containing 5
Synonyms: API4; EPR-1; baculoviral IAP repeat-containing protein 5; apoptosis inhibitor 4; apoptosis inhibitor survivin; survivin variant 3 alpha; baculoviral IAP repeat containing 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtgccccgacgttgccccctgcctggcagccctttctcaaggaccaccgcatctctacattcaagaactggcccttcttggagggctgcgcctgcaccccggagcggatggccgaggctggcttcatccactgccccactgagaacgagccagacttggcccagtgtttcttctgcttcaaggagctggaaggctgggagccagatgacgaccccatagaggaacataaaaagcattcgtccggttgcgctttcctttctgtcaagaagcagtttgaagaattaacccttggtgaatttttgaaactggacagagaaagagccaagaacaaaattgcaaaggaaaccaacaataagaagaaagaatttgaggaaactgcgaagaaagtgcgccgtgccatcgagcagctggctgccatggattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - heat shock factor binding protein 1
- regulator of G-protein signaling 13
- LIM domain only 2 (rhombotin-like 1)
- myosin regulatory light chain MRLC2

Buy BIRC5-baculoviral IAP repeat-containing 5 Gene now

Add to cart