Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of BIRC5-baculoviral IAP repeat-containing 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BIRC5-baculoviral IAP repeat-containing 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008718 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BIRC5 |
| Origin species: | Human |
| Product name: | BIRC5-baculoviral IAP repeat-containing 5 Gene |
| Size: | 2ug |
| Accessions: | BC008718 |
| Gene id: | 332 |
| Gene description: | baculoviral IAP repeat-containing 5 |
| Synonyms: | API4; EPR-1; baculoviral IAP repeat-containing protein 5; apoptosis inhibitor 4; apoptosis inhibitor survivin; survivin variant 3 alpha; baculoviral IAP repeat containing 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtgccccgacgttgccccctgcctggcagccctttctcaaggaccaccgcatctctacattcaagaactggcccttcttggagggctgcgcctgcaccccggagcggatggccgaggctggcttcatccactgccccactgagaacgagccagacttggcccagtgtttcttctgcttcaaggagctggaaggctgggagccagatgacgaccccatagaggaacataaaaagcattcgtccggttgcgctttcctttctgtcaagaagcagtttgaagaattaacccttggtgaatttttgaaactggacagagaaagagccaagaacaaaattgcaaaggaaaccaacaataagaagaaagaatttgaggaaactgcgaagaaagtgcgccgtgccatcgagcagctggctgccatggattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - heat shock factor binding protein 1 - regulator of G-protein signaling 13 - LIM domain only 2 (rhombotin-like 1) - myosin regulatory light chain MRLC2 |