Login to display prices
Login to display prices
HSBP1-heat shock factor binding protein 1 Gene View larger

HSBP1-heat shock factor binding protein 1 Gene

PTXBC007515

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSBP1-heat shock factor binding protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HSBP1-heat shock factor binding protein 1 Gene

Proteogenix catalog: PTXBC007515
Ncbi symbol: HSBP1
Product name: HSBP1-heat shock factor binding protein 1 Gene
Size: 2ug
Accessions: BC007515
Gene id: 3281
Gene description: heat shock factor binding protein 1
Synonyms: NPC-A-13; heat shock factor-binding protein 1; nasopharyngeal carcinoma-associated antigen 13; heat shock factor binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgagactgaccccaagaccgtgcaggacctcacctcggtggtgcagacactcctgcagcagatgcaagataaatttcagaccatgtctgaccagatcattgggagaattgatgatatgagtagtcgcattgatgatctggaaaagaatatcgcggacctcatgacacaggctggggtggaagaactggaaagtgaaaacaagatacctgccacgcaaaagagttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: