Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MRLC2-myosin regulatory light chain MRLC2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRLC2-myosin regulatory light chain MRLC2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004994 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRLC2 |
| Origin species: | Human |
| Product name: | MRLC2-myosin regulatory light chain MRLC2 Gene |
| Size: | 2ug |
| Accessions: | BC004994 |
| Gene id: | 103910 |
| Gene description: | myosin regulatory light chain MRLC2 |
| Synonyms: | myosin regulatory light chain MRLC2; MRLC2; MLC-B; myosin regulatory light chain 12B; MLC-2; MLC-2A; MLC20; SHUJUN-1; myosin regulatory light chain 2; myosin regulatory light chain 2-B, smooth muscle isoform; myosin regulatory light chain 20 kDa; myosin, light chain 12B, regulatory; myosin light chain 12B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgagcaaaaaggcaaagaccaagaccaccaagaagcgccctcagcgtgcaacatccaatgtgtttgccatgtttgaccagtcacagattcaggagttcaaagaggccttcaacatgattgatcagaacagagatggcttcatcgacaaggaagatttgcatgatatgcttgcttctctagggaagaatcccactgatgcataccttgatgccatgatgaatgaggccccagggcccatcaatttcaccatgttcctgaccatgtttggtgagaagttaaatggcacagatcctgaagatgtcatcagaaacgcctttgcttgctttgatgaagaagcaacaggcaccattcaggaagattacctaagagagctgctgacaaccatgggggatcggtttacagatgaggaagtggatgagctgtacagagaagcacctattgacaaaaaggggaatttcaattacatcgagttcacacgcatcctgaaacatggagccaaagacaaagatgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - YKT6 v-SNARE homolog (S. cerevisiae) - aminolevulinate, delta-, synthase 2 - baculoviral IAP repeat-containing 2 - Mdm1 nuclear protein homolog (mouse) |