SUPT4H1-suppressor of Ty 4 homolog 1 (S. cerevisiae) Gene View larger

SUPT4H1-suppressor of Ty 4 homolog 1 (S. cerevisiae) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SUPT4H1-suppressor of Ty 4 homolog 1 (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SUPT4H1-suppressor of Ty 4 homolog 1 (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002802
Product type: DNA & cDNA
Ncbi symbol: SUPT4H1
Origin species: Human
Product name: SUPT4H1-suppressor of Ty 4 homolog 1 (S. cerevisiae) Gene
Size: 2ug
Accessions: BC002802
Gene id: 6827
Gene description: suppressor of Ty 4 homolog 1 (S. cerevisiae)
Synonyms: SPT4; SPT4H; SUPT4H; Supt4a; transcription elongation factor SPT4; DRB sensitivity-inducing factor 14 kDa subunit; DSIF p14; small hSpt4 subunit; suppressor of Ty 4 homolog 1; SPT4 homolog, DSIF elongation factor subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctggagacggtgccgaaggacctgcggcatctgcgggcctgtttgctgtgttcgctggtcaagactatagaccagtttgaatatgatggttgtgacaattgtgatgcatatctacaaatgaagggtaaccgagagatggtatatgactgcactagctcttcctttgatggaatcattgcgatgatgagtccagaggacagctgggtctccaagtggcagcgagtcagtaactttaagccaggtgtatatgcggtgtcagtcactggtcgcctgccccaaggaatcgtgcgggagctgaaaagtcgaggagtggcctacaaatccagagacacagctataaagacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin-conjugating enzyme E2D 4 (putative)
- nucleolar protein 5A (56kDa with KKE/D repeat)
- cell division cycle 20 homolog (S. cerevisiae)
- receptor-interacting serine-threonine kinase 2

Buy SUPT4H1-suppressor of Ty 4 homolog 1 (S. cerevisiae) Gene now

Add to cart