Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SUPT4H1-suppressor of Ty 4 homolog 1 (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SUPT4H1-suppressor of Ty 4 homolog 1 (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002802 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SUPT4H1 |
| Origin species: | Human |
| Product name: | SUPT4H1-suppressor of Ty 4 homolog 1 (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC002802 |
| Gene id: | 6827 |
| Gene description: | suppressor of Ty 4 homolog 1 (S. cerevisiae) |
| Synonyms: | SPT4; SPT4H; SUPT4H; Supt4a; transcription elongation factor SPT4; DRB sensitivity-inducing factor 14 kDa subunit; DSIF p14; small hSpt4 subunit; suppressor of Ty 4 homolog 1; SPT4 homolog, DSIF elongation factor subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccctggagacggtgccgaaggacctgcggcatctgcgggcctgtttgctgtgttcgctggtcaagactatagaccagtttgaatatgatggttgtgacaattgtgatgcatatctacaaatgaagggtaaccgagagatggtatatgactgcactagctcttcctttgatggaatcattgcgatgatgagtccagaggacagctgggtctccaagtggcagcgagtcagtaactttaagccaggtgtatatgcggtgtcagtcactggtcgcctgccccaaggaatcgtgcgggagctgaaaagtcgaggagtggcctacaaatccagagacacagctataaagacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin-conjugating enzyme E2D 4 (putative) - nucleolar protein 5A (56kDa with KKE/D repeat) - cell division cycle 20 homolog (S. cerevisiae) - receptor-interacting serine-threonine kinase 2 |