Login to display prices
Login to display prices
UBE2D4-ubiquitin-conjugating enzyme E2D 4 (putative) Gene View larger

UBE2D4-ubiquitin-conjugating enzyme E2D 4 (putative) Gene

PTXBC004104

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2D4-ubiquitin-conjugating enzyme E2D 4 (putative) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2D4-ubiquitin-conjugating enzyme E2D 4 (putative) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004104
Product type: DNA & cDNA
Ncbi symbol: UBE2D4
Origin species: Human
Product name: UBE2D4-ubiquitin-conjugating enzyme E2D 4 (putative) Gene
Size: 2ug
Accessions: BC004104
Gene id: 51619
Gene description: ubiquitin-conjugating enzyme E2D 4 (putative)
Synonyms: HBUCE1; ubiquitin-conjugating enzyme E2 D4; E2 ubiquitin-conjugating enzyme D4; ubiquitin carrier protein D4; ubiquitin conjugating enzyme E2D 4 (putative); ubiquitin-conjugating enzyme HBUCE1; ubiquitin-protein ligase D4; ubiquitin conjugating enzyme E2 D4 (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctaaagcggatccagaaggaattaaccgacttgcagagggatcctcctgcccagtgttctgcaggacctgtcggtgatgacttgttccactggcaggccaccatcatgggcccgaatgacagtccttaccaaggaggtgttttcttcctgaccatccactttcctacagattacccgttcaagcccccaaaggttgctttcacaaccaaaatttatcaccctaatatcaacagcaatggcagcatctgccttgatatcctgcggtctcagtggtctccagcgttgactgtgtcaaaagttctcttgtccatctgctcgctgctctgcgaccccaaccccgatgaccccctggtgccagagatagcacacacctacaaggccgacagagagaagtacaacagactagcaagagagtggacacaaaaatatgctatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nucleolar protein 5A (56kDa with KKE/D repeat)
- cell division cycle 20 homolog (S. cerevisiae)
- receptor-interacting serine-threonine kinase 2
- erythrocyte membrane protein band 4.1-like 2