Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NOL5A-nucleolar protein 5A (56kDa with KKE/D repeat) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NOL5A-nucleolar protein 5A (56kDa with KKE/D repeat) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004937 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NOL5A |
| Origin species: | Human |
| Product name: | NOL5A-nucleolar protein 5A (56kDa with KKE/D repeat) Gene |
| Size: | 2ug |
| Accessions: | BC004937 |
| Gene id: | 10528 |
| Gene description: | nucleolar protein 5A (56kDa with KKE/D repeat) |
| Synonyms: | NOL5A; SCA36; nucleolar protein 56; NOP56 ribonucleoprotein homolog; nucleolar protein 5A (56kDa with KKE/D repeat); NOP56 ribonucleoprotein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggaagcaatggttcaggcagaggaagcggctgctgagattactaggaagctggagaaacaggagaagaaacgcttaaagaaggaaaagaaacggctggctgcacttgccctcgcgtcttcagaaaacagcagtagtactccagaggagtgtgaggagatgagtgaaaaacccaaaaagaagaaaaagcaaaagccccaggaggttcctcaggagaatggaatggaagacccatctatctctttctccaaacccaagaaaaagaaatctttttccaaggaggagttgatgagtagcgatcttgaagagaccgctggcagcaccagtattcccaagaggaagaagtctacacccaaggaggaaacagttaatgaccctgaggaggcaggccacagaagtggctccaagaaaaagaggaaattctccaaagaggagccggtcagcagtgggcctgaagaggcggttggcaagagcagctccaagaagaagaaaaagttccataaagcatcccaggaagattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cell division cycle 20 homolog (S. cerevisiae) - receptor-interacting serine-threonine kinase 2 - erythrocyte membrane protein band 4.1-like 2 - acyl-CoA synthetase bubblegum family member 1 |