No products
Prices are tax excluded
PTXBC004937
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC004937 |
Product type: | DNA & cDNA |
Ncbi symbol: | NOL5A |
Origin species: | Human |
Product name: | NOL5A-nucleolar protein 5A (56kDa with KKE/D repeat) Gene |
Size: | 2ug |
Accessions: | BC004937 |
Gene id: | 10528 |
Gene description: | nucleolar protein 5A (56kDa with KKE/D repeat) |
Synonyms: | NOL5A; SCA36; nucleolar protein 56; NOP56 ribonucleoprotein homolog; nucleolar protein 5A (56kDa with KKE/D repeat); NOP56 ribonucleoprotein |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaaggaagcaatggttcaggcagaggaagcggctgctgagattactaggaagctggagaaacaggagaagaaacgcttaaagaaggaaaagaaacggctggctgcacttgccctcgcgtcttcagaaaacagcagtagtactccagaggagtgtgaggagatgagtgaaaaacccaaaaagaagaaaaagcaaaagccccaggaggttcctcaggagaatggaatggaagacccatctatctctttctccaaacccaagaaaaagaaatctttttccaaggaggagttgatgagtagcgatcttgaagagaccgctggcagcaccagtattcccaagaggaagaagtctacacccaaggaggaaacagttaatgaccctgaggaggcaggccacagaagtggctccaagaaaaagaggaaattctccaaagaggagccggtcagcagtgggcctgaagaggcggttggcaagagcagctccaagaagaagaaaaagttccataaagcatcccaggaagattag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - cell division cycle 20 homolog (S. cerevisiae) - receptor-interacting serine-threonine kinase 2 - erythrocyte membrane protein band 4.1-like 2 - acyl-CoA synthetase bubblegum family member 1 |