Login to display prices
Login to display prices
GFM2-G elongation factor, mitochondrial 2 Gene View larger

GFM2-G elongation factor, mitochondrial 2 Gene

PTXBC015712

New product

Data sheet of GFM2-G elongation factor, mitochondrial 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GFM2-G elongation factor, mitochondrial 2 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC015712
Ncbi symbol: GFM2
Product name: GFM2-G elongation factor, mitochondrial 2 Gene
Size: 2ug
Accessions: BC015712
Gene id: 84340
Gene description: G elongation factor, mitochondrial 2
Synonyms: EF-G2mt; EFG2; MRRF2; MST027; MSTP027; RRF2; RRF2mt; mEF-G 2; ribosome-releasing factor 2, mitochondrial; mitochondrial elongation factor G2; mitochondrial ribosome recycling factor 2; G elongation factor mitochondrial 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgaccaacttgaggatatttgcaatgagtcatcagacaatacccagtgtgtatattaataatatatgctgctataaaataagagcaagtttaaaaagattaaagccacatgtgccgcttggaagaaattgcagttctctaccaggcttaataggaaatgatatcaaatcccttcattccatcatcaatcctcccatagctaaaatccgtaatattggaattatggctcatattgatgcaggcaaaactaccaccacagaaagaatattgtactattccggatatacaagatcactgggagatgttgatgatggagacacagtgacagatttcatggcccaagagcgagaaagaggcattactattcaatcagctgctgttacatttgattggaaaggttatagagtcaatctaattgatacaccaggtcatgtggactttaccttggaggttgagcggtgcctaagagtgttggatggtgcagtggctgtatttgatgcctctgctggtgtagaggcccagactctcacagtatggaggcaagctgataaacacaatatacctcgaatctgttttttaaacaagatggacaaaactggagcaagctttaagtatgcagttgaaagcatcagagagaagttaaaggcaaagcctttgcttttacagttaccaattggtgaagccaaaactttcaaaggagtggtggatgtagtaatgaaagaaaaacttctttggaattgcaattcaaatgatggaaaagactttgagagaaagcccctcttggaaatgaatgatcctgaattgctgaaggaaacaactgaagcaaggaatgccttaattgaacaagttgcagatttggatgatgaatttgctgacttggttttagaagaatttagtgagaattttgatttgttaccagctgaaaagctacagactgcaatacatagagtgacactagctcagacagcagtgcctgtgctttgtggaagtgccctgaaaaacaaagggatacagcccttgttagatgctgttactatgtacttaccttcacctgaagagcgtaactatgaatttctgcagtggtataaggatgacttatgtgcattggcatttaaagttctccatgacaagcagcgaggaccactggtttttatgcgcatttactcaggcactataaaaccccagttggccattcataatattaatggaaactgcacggagagaataagtcgtctgcttttgccgtttgctgaccaacatgtagaaatcccttcattgactgctggtaacattgctttgactgttgggcttaaacatactgccactggagacaccattgtctcatccaagtccagtgcattagctgcagctcgtagagccgaacgggagggagaaaagaagcacagacaaaacaatgaagcagagagacttttattggctggagtggagattccagaacctgttttcttctgtaccatagaacccccatcactgtctaagcagccagatttggaacatgcgttgaaatgtcttcagcgtgaagatcccagtttgaaagtgaggctagatcctgactctggacaaactgttctgtgtggtatgggggagttacatatagagattattcatgatcgaatcaagagggaatatggactggagacctatctcgggcctctccaggtggcatatcgagagaccatcctaaactcagttcgtgccacagataccttagatagaactttaggagacaaaaggcatcttgtgactgtagaagtggaagcaaggccaattgaaacatcatctgttatgcctgtgattgagtttgagtatgctgaaagtatcaatgaaggccttttgaaggtctcccaagaggccattgaaaatggaattcacagcgcatgtctccaaggaccattgcttggatccccaattcaggatgtagcaattactttacattccctgacaattcatcctggcacctccacaactatgatttctgcctgtgtctcaagatgcgtgcaaaaggctctgaagaaagctgataagcaagttttggagcctctgatgaatcttgaggttacagtagctagagattatctcagccctgtcctggcagatctggcacaaagaagaggaaacattcaggaaattcagactcgccaggacaacaaagttgttattggatttgttcccttagcagaaattatgggttattcaactgtgcttcgaacgctaacatcaggctcagctacttttgccttagaactatctacttatcaagccatgaatcctcaagatcaaaatacactgctcaaccggagaagtggtttgacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: