IKZF1-IKAROS family zinc finger 1 (Ikaros) Gene View larger

IKZF1-IKAROS family zinc finger 1 (Ikaros) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IKZF1-IKAROS family zinc finger 1 (Ikaros) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IKZF1-IKAROS family zinc finger 1 (Ikaros) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018349
Product type: DNA & cDNA
Ncbi symbol: IKZF1
Origin species: Human
Product name: IKZF1-IKAROS family zinc finger 1 (Ikaros) Gene
Size: 2ug
Accessions: BC018349
Gene id: 10320
Gene description: IKAROS family zinc finger 1 (Ikaros)
Synonyms: CVID13; Hs.54452; IK1; IKAROS; LYF1; LyF-1; PPP1R92; PRO0758; ZNFN1A1; DNA-binding protein Ikaros; CLL-associated antigen KW-6; ikaros family zinc finger protein 1; lymphoid transcription factor LyF-1; protein phosphatase 1, regulatory subunit 92; zinc finger protein, subfamily 1A, 1 (Ikaros); IKAROS family zinc finger 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgctgatgagggtcaagacatgtcccaagtttcagggaaggaaagcccccctgtaagcgatactccagatgagggcgatgagcccatgccgatccccgaggacctctccaccacctcgggaggacagcaaagctccaagagtgacagagtcgtggccagtaatgttaaagtagagactcagagtgatgaagagaatgggcgtgcctgtgaaatgaatggggaagaatgtgcggaggatttacgaatgcttgatgcctcgggagagaaaatgaatggctcccacagggaccaaggcagctcggctttgtcgggagttggaggcattcgacttcctaacggaaaactaaagtgtgatatctgtgggatcatttgcatcgggcccaatgtgctcatggttcacaaaagaagccacactggagaacggcccttccagtgcaatcagtgcggggcctcattcacccagaagggcaacctgctccggcacatcaagctgcattccggggagaagcccttcaaatgccacctctgcaactacgcctgccgccggagggacgccctcactggccacctgaggacgcactccgtcattaaagaagaaactaatcacagtgaaatggcagaagacctgtgcaagataggatcagagagatctctcgtgctggacagactagcaagtaacgtcgccaaacgtaagagctctatgcctcagaaatttcttggggacaagggcctgtccgacacgccctacgacagcagcgccagctacgagaaggagaacgaaatgatgaagtcccacgtgatggaccaagccatcaacaacgccatcaactacctgggggccgagtccctgcgcccgctggtgcagacgcccccgggcggttccgaggtggtcccggtcatcagcccgatgtaccagctgcacaagccgctcgcggagggcaccccgcgctccaaccactcggcccaggacagcgccgtggagaacctgctgctgctctccaaggccaagttggtgccctcggagcgcgaggcgtccccgagcaacagctgccaagactccacggacaccgagagcaacaacgaggagcagcgcagcggtctcatctacctgaccaaccacatcgccccgcacgcgcgcaacgggctgtcgctcaaggaggagcaccgcgcctacgacctgctgcgcgccgcctccgagaactcgcaggacgcgctccgcgtggtcagcaccagcggggagcagatgaaggtgtacaagtgcgaacactgccgggtgctcttcctggatcacgtcatgtacaccatccacatgggctgccacggcttccgtgatccttttgagtgcaacatgtgcggctaccacagccaggaccggtacgagttctcgtcgcacataacgcgaggggagcaccgcttccacatgagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 98
- retinitis pigmentosa GTPase regulator
- chromosome 2 open reading frame 30
- solute carrier family 38, member 1

Buy IKZF1-IKAROS family zinc finger 1 (Ikaros) Gene now

Add to cart