C2orf30-chromosome 2 open reading frame 30 Gene View larger

C2orf30-chromosome 2 open reading frame 30 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C2orf30-chromosome 2 open reading frame 30 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C2orf30-chromosome 2 open reading frame 30 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013129
Product type: DNA & cDNA
Ncbi symbol: C2orf30
Origin species: Human
Product name: C2orf30-chromosome 2 open reading frame 30 Gene
Size: 2ug
Accessions: BC013129
Gene id: 27248
Gene description: chromosome 2 open reading frame 30
Synonyms: C2orf30; CIM; CL24936; CL25084; HEL117; XTP3-B; XTP3TPB; endoplasmic reticulum lectin 1; ER lectin; XTP3-transactivated gene B protein; XTP3-transactivated protein B; cancer invasion and metastasis-related; epididymis luminal protein 117; erlectin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggaaggaggcggcggcgtacggagtctggtcccgggcgggccggtgttactggtcctctgcggcctcctggaggcgtccggcggcggccgagcccttcctcaactcagcgatgacatccctttccgagtcaactggcccggcaccgagttctctctgcccacaactggagttttatataaagaagataattatgtcatcatgacaactgcacataaagaaaaatataaatgcatacttccccttgtgacaagtggggatgaggaagaagaaaaggattataaaggccctaatccaagagagcttttggagccactatttaaacaaagcagttgttcctacagaattgagtcttattggacttacgaagtatgtcatggaaaacacattcggcagtaccatgaagagaaagaaactggtcagaaaataaatattcacgagtactaccttgggaatatgttggccaagaaccttctatttgaaaaagaacgagaagcagaagaaaaggaaaaatcaaatgagattcccactaaaaatatcgaaggtcagatgacaccatactatcctgtgggaatgggaaatggtacaccttgtagtttgaaacagaaccggcccagatcaagtactgtgatgtacatatgtcatcctgaatctaagcatgaaattctttcagtagctgaagttacaacttgtgaatatgaagttgtcattttgacaccactcttgtgcagtcatcctaaatataggttcagagcatctcctgtgaatgacatattttgtcaatcactgccaggatctccatttaagcccctcaccctgaggcagctggagcagcaggaagaaatactaagggtgccttttaggagaaataaagaggaagatttgcaatcaactaaagaagagagatttccagcgatccacaagtcgattgctattggctctcagccagtgctcactgttgggacaacccacatatccaaattgacagatgaccaactcataaaagagtttcttagtggttcttactgctttcgtgggggtgtcggttggtggaaatatgaattctgctatggcaaacatgtacatcaataccatgaggacaaggatagtgggaaaacctctgtggttgtcgggacatggaaccaagaagagcatattgaatgggctaagaagaatactgctagagcttatcatcttcaagacgatggtacccagacagtcaggatggtgtcacatttttatggaaatggagatatttgtgatataactgacaaaccaagacaggtgactgtaaaactaaagtgcaaagaatcagattcacctcatgctgttactgtatatatgctagagcctcactcctgtcaatatattcttggggttgaatctccagtgatctgtaaaatcttagatacagcagatgaaaatggacttctttctctccccaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 38, member 1
- chromosome 9 open reading frame 97
- solute carrier family 41, member 2
- solute carrier family 19, member 3

Buy C2orf30-chromosome 2 open reading frame 30 Gene now

Add to cart