RPGR-retinitis pigmentosa GTPase regulator Gene View larger

RPGR-retinitis pigmentosa GTPase regulator Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPGR-retinitis pigmentosa GTPase regulator Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPGR-retinitis pigmentosa GTPase regulator Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031624
Product type: DNA & cDNA
Ncbi symbol: RPGR
Origin species: Human
Product name: RPGR-retinitis pigmentosa GTPase regulator Gene
Size: 2ug
Accessions: BC031624
Gene id: 6103
Gene description: retinitis pigmentosa GTPase regulator
Synonyms: COD1; CORDX1; CRD; PCDX; RP15; RP3; XLRP3; orf15; X-linked retinitis pigmentosa GTPase regulator; retinitis pigmentosa 15; retinitis pigmentosa 3 GTPase regulator; retinitis pigmentosa GTPase regulator
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagggagccggaagagctgatgcccgattcgggtgctgtgtttacatttgggaaaagtaaatttgctgaaaataatcccggtaaattctggtttaaaaatgatgtccctgtacatctttcatgtggagatgaacattctgctgttgttaccggaaataataaactttacatgtttggcagtaacaactggggtcagttaggattaggatcaaagtcagccatcagcaagccaacatgtgtcaaagctctaaaacctgaaaaagtgaaattagctgcctgtggaaggaaccacaccctggtgtcaacagaaggaggcaatgtatatgcaactggtggaaataatgaaggacagttggggcttggtgacaccgaagaaagaaacacttttcatgtaattagcttttttacatccgagcataagattaagcagctgtctgctggatctaatacttcagctgccctaactgaggatggaagactttttatgtggggtgacaattccgaagggcaaattggtttaaaaaatgtaagtaatgtctgtgtccctcagcaagtgaccattgggaaacctgtctcctggatctcttgtggatattaccattcagcttttgtaacaacagatggtgagctatatgtgtttggagaacctgagaatgggaagttaggtcttcccaatcagctcctgggcaatcacagaacaccccagctggtgtctgaaattccggagaaggtgatccaagtagcctgtggtggagagcatactgtggttctcacggagaatgctgtgtatacctttgggctgggacaatttggtcagctgggtcttggcacttttctttttgaaacttcagaacccaaagtcattgagaatattagggatcaaacaataagttatatttcttgtggagaaaatcacacagctttgataacagatatcggccttatgtatacttttggagatggtcgccacggaaaattaggacttggactggagaattttaccaatcacttcattcctactttgtgctctaattttttgaggtttatagttaaattggttgcttgtggtggatgtcacatggtagtttttgctgctcctcatcgtggtgtggcaaaagaaattgaatttgatgaaataaatgatacttgcttatctgtggcgacttttctgccgtatagcagtttaacctcaggaaatgtactgcagaggactctatcagcacgtatgcggcgaagagagagggagaggtctccagattctttttcaatgaggagaacactacctccaatagaagggactcttggcctttctgcttgttttctccccaattcagtctttccacgatgttctgagagaaacctccaagagagtgtcttatctgaacaggacctcatgcagccagaggaaccagacacacatcatgagcctgaattccaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 2 open reading frame 30
- solute carrier family 38, member 1
- chromosome 9 open reading frame 97
- solute carrier family 41, member 2

Buy RPGR-retinitis pigmentosa GTPase regulator Gene now

Add to cart