Login to display prices
Login to display prices
DGCR14-DiGeorge syndrome critical region gene 14 Gene View larger

DGCR14-DiGeorge syndrome critical region gene 14 Gene

PTXBC006542

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DGCR14-DiGeorge syndrome critical region gene 14 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DGCR14-DiGeorge syndrome critical region gene 14 Gene

Proteogenix catalog: PTXBC006542
Ncbi symbol: DGCR14
Product name: DGCR14-DiGeorge syndrome critical region gene 14 Gene
Size: 2ug
Accessions: BC006542
Gene id: 8220
Gene description: DiGeorge syndrome critical region gene 14
Synonyms: protein DGCR14; DGCR13; DGS-H; DGS-I; DGSH; DGSI; ES2; Es2el; DiGeorge syndrome critical region gene 13; DiGeorge syndrome critical region gene DGSI; DiGeorge syndrome gene H; DiGeorge syndrome gene I; Protein DGCR13; diGeorge syndrome protein H; DiGeorge syndrome critical region gene 14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagacgccgggcgcatcagcgtcgtccttgttgcttcccgccgcgtccaggcccccgaggaagcgcgaggcgggagaggctggggctgcgacgagcaagcagcgggtcctggacgaggaagagtatatcgagggcctccagacggtcatccaaagggatttctttcctgatgtggagaagctccaggcacagaaggagtacctggaagccgaggagaatggagacttggaacggatgcgccagattgccatcaagtttggctctgccttgggcaagatgtcccgggagcccccgccaccctatgtgactccagccacatttgaaacccctgaggtgcatgcaggcactggagtggtgggcaacaagcccaggccccgcggccgaggcctggaggatggagaggctggagaggaggaggagaaggagccgctgcccagcctagatgtcttcctgagccgctacacgagtgaggacaatgcctccttccaggagatcatggaggtggccaaggagagaagccgggcacgccacgcttggctctaccaggctgaggaagagtttgagaagaggcagaaagataatctcgaactcccgtcagcagagcaccaggccatcgagagcagccaggccagtgtggagacctggaagtacaaggccaagaattccctcatgtactatccagagggtgtccctgacgaggagcagctgtttaagaagccccggcaggtggtacataagaacacgcgcttccttagggaccccttcagccaagccctgagcaggtgccagctccagcaggcagccgccctcaatgcccagcacaaacagggcaaggtgggccccgatggcaaggagctgatcccccaggagtcccctcgagtgggtggatttggatttgttgccactccttcccctgcccctggtgtgaacgagtccccgatgatgacctggggggaggttgagaacacacccttgagagttgaagggtcggaaacgccctacgtggacaggacacccggcccagcttttaagatcctggagccaggccgcagggagcggctgggtctgaagatggccaacgaggccgctgccaagaaccgggccaagaagcaggaagccttgcggagagtgacggagaatctggccagcctcacccccaaaggcctgagcccagccatgtcgccagccctacagcgccttgtgagcaggacggccagcaagtacacagaccgggccctgcgggccagctacacaccatccccagcacgctccacccacctcaagaccccggccagtgggctgcagacccccacaagcacaccggcgcctggctctgccacacgcacccctctcacacaggacccggcctccatcacggacaacctgctgcagctccctgcccggcgcaaagcttcggacttcttttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: