GTF2A1L-general transcription factor IIA, 1-like Gene View larger

GTF2A1L-general transcription factor IIA, 1-like Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GTF2A1L-general transcription factor IIA, 1-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GTF2A1L-general transcription factor IIA, 1-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025991
Product type: DNA & cDNA
Ncbi symbol: GTF2A1L
Origin species: Human
Product name: GTF2A1L-general transcription factor IIA, 1-like Gene
Size: 2ug
Accessions: BC025991
Gene id: 11036
Gene description: general transcription factor IIA, 1-like
Synonyms: ALF; TFIIA-alpha and beta-like factor; GTF2A1-like factor; TFIIA large subunit isoform ALF; TFIIA-alpha/beta-like factor; general transcription factor II A, 1-like factor; general transcription factor IIA 1-like; testis secretory sperm-binding protein Li 230m; general transcription factor IIA subunit 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctgcctcaacccggtgcctaaactctacagatctgtaattgaagatgtaattgaaggagttcggaatctatttgctgaagaaggtatagaggaacaagttttaaaagacttgaagcagctctgggaaaccaaggttttgcagtctaaagcaacagaagacttcttcagaaatagcatccaatcacctctgtttactcttcagttgccgcacagcttgcaccaaacattgcaatcgtcaacagcatcattagttattcctgctggtagaactcttccaagttttaccacagcagaactgggcacttcaaactccagtgcaaactttacttttcctggttatcccattcatgtaccagcaggtgtgacactacagactgtatctggtcacctttataaagtcaatgtaccaattatggtgacagagacttctggaagagcaggtattcttcagcatccaattcagcaagtatttcaacagcttggccagccttcagtaatacaaactagtgttccacaattgaatccatggtctcttcaagcaactactgaaaaatcacagagaattgaaaccgtgctacagcaacccgcaattctaccttctgggccagtagataggaaacacttagaaaatgccaccagtgatatacttgtatctcctggaaatgagcataaaatcgtgcctgaagctttgttgtgtcatcaggaaagttctcactatatcagtcttccaggtgttgtattttctccacaggtctctcaaacaaattctaatgtggagtcagtgctcagtggttcagctagcatggctcaaaatctgcatgatgagtccctctccacaagccctcatggggctctccaccagcacgtgactgatattcagcttcatattcttaaaaataggatgtatggatgtgattctgtaaagcaaccaagaaatatagaggaacccagcaacatacctgtatcagagaaggattctaattctcaggtggatttaagcattcgggttactgatgatgatattggtgaaataattcaagtagatggaagcggtgatacatcttccaatgaagaaataggaagtacaagagatgcagatgagaatgaatttctagggaatattgacgggggagatctgaaggtacctgaagaagaagctgacagtatttcaaatgaggattcagccacaaacagtagtgataatgaagaccctcaagtaaacattgtagaagaggaccctttaaattctggagatgatgttagtgaacaggatgtgccagacctgtttgacacggataatgttattgtctgtcagtatgataagattcatcgaagcaagaacaaatggaaattctatttgaaagatggtgttatgtgttttggagggagagactatgtatttgcaaaagccattggtgatgcagagtggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SLIT-ROBO Rho GTPase activating protein 1
- pyruvate dehydrogenase complex, component X
- UDP-N-acteylglucosamine pyrophosphorylase 1
- serine peptidase inhibitor, Kunitz type 1

Buy GTF2A1L-general transcription factor IIA, 1-like Gene now

Add to cart