Login to display prices
Login to display prices
SRGAP1-SLIT-ROBO Rho GTPase activating protein 1 Gene View larger

SRGAP1-SLIT-ROBO Rho GTPase activating protein 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SRGAP1-SLIT-ROBO Rho GTPase activating protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SRGAP1-SLIT-ROBO Rho GTPase activating protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029919
Product type: DNA & cDNA
Ncbi symbol: SRGAP1
Origin species: Human
Product name: SRGAP1-SLIT-ROBO Rho GTPase activating protein 1 Gene
Size: 2ug
Accessions: BC029919
Gene id: 57522
Gene description: SLIT-ROBO Rho GTPase activating protein 1
Synonyms: ARHGAP13; NMTC2; SLIT-ROBO Rho GTPase-activating protein 1; rho GTPase-activating protein 13; SLIT-ROBO Rho GTPase activating protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgagttcagcttctccaggatctgcaagatttcttccgaaaaaaagctgaaattgagacggaatattcccggaatctagagaagttagcagaaaggttcatggcaaaaacaagaagcactaaggatcatcaacaatacaagaaagaccagaacctgttgtctccagtgaactgctggtatttgctcctgaaccaagtaaggagagaaagcaaagaccatgcaaccttgagtgacatctatctgaacaatgtgattatgcggttcatgcagataagtgaggattctaccaggatgtttaaaaagagcaaagagattgcattccaacttcatgaggatttaatgaaggttcttaatgagctttatacggtgatgaaaacataccatatgtatcatgcagagagcatcagtgcagagagcaagctgaaagaggccgaaaaacaagaggaaaagcaaattgggagatctggtgatccagtcttccatattcgactagaggagagacatcaacggcgaagctctgtaaagaaaattgaaaaaatgaaagaaaaaagacaagcaaaatattcagaaaataagctaaaatcaattaaggcacggaacgaatatctcctaacacttgaagccaccaatgcctcagttttcaagtactatattcatgatctttctgatttaattgattgctgtgatcttggctaccatgcaagtctgaacagagccctaagaacatatctgtctgcggagtacaaccttgaaacctccagacatgagggcttagacattattgagaatgcagttgataatttagagcccaggagcgataagcagagattcatggagatgtaccctgctgcgttctgtccaccaatgaagtttgagtttcagtctcacatgggtgatgaggtgtgccaggtcagtgcccagcagccagtccaggcagagctcatgctcaggtaccaacagttgcagtcccgccttgccacgctcaaaatcgagaatgaagaggttaagaaaacgactgaagccaccttgcagacgatacaagatatggtcaccatcgaggactatgatgtttctgaatgcttccagcacagtcgttccacagaatctgtgaagtccactgtctctgaaacctacctgagtaaacccagcatcgccaagagaagagccaaccagcaggaaactgaacagttctacttcatgaaactcagagaatatttggaaggcagtaatctcatcacaaaacttcaagccaaacatgacttgctgcagaggaccctgggagaaggtgagttatccaaaatgtatgggaagatgacctggatgatacatcgtatcatgtatatattccagaaagagtatgaattgtatatttgtgctttaagaagcagaggacactctgtgtttagatttggttttgtttgtatatgtcatgattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pyruvate dehydrogenase complex, component X
- UDP-N-acteylglucosamine pyrophosphorylase 1
- serine peptidase inhibitor, Kunitz type 1
- male-specific lethal 3 homolog (Drosophila)