MSL3-male-specific lethal 3 homolog (Drosophila) Gene View larger

MSL3-male-specific lethal 3 homolog (Drosophila) Gene


New product

Data sheet of MSL3-male-specific lethal 3 homolog (Drosophila) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MSL3-male-specific lethal 3 homolog (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031210
Product type: DNA & cDNA
Ncbi symbol: MSL3
Origin species: Human
Product name: MSL3-male-specific lethal 3 homolog (Drosophila) Gene
Size: 2ug
Accessions: BC031210
Gene id: 10943
Gene description: male-specific lethal 3 homolog (Drosophila)
Synonyms: MSL3-like 1; MSL3L1; male-specific lethal 3 homolog; male-specific lethal-3 protein-like 1; male-specific lethal 3 homolog (Drosophila)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcgcgagcgagggcatgaaatttaaattccactcaggggagaaagtgctgtgcttcgagcctgaccccaccaaggcgcgagtgctgtacgatgccaagattgttgatgttattgttgggaaagacgaaaaaggcagaaagatcccagaatatctgatccattttaatggttggaacagaagctgggatagatgggcagcagaagatcatgtgcttcgtgataccgatgaaaatcgtagattacagcgtaaattggcaagaaaagctgtagctcgcctgaggagcacaggaagaaagaagaagcgctgcaggttgcctggtgtggactctgtcttaaaaggcctccccactgaagaaaaagatgaaaatgatgaaaactcattaagcagttcctctgactgtagtgaaaacaaggatgaagaaataagtgaagaaagtgatattgaagaaaagactgaagtgaaagaagaaccagagcttcaaacaagaagggaaatggaagaaagaacaataactatagaaatccctgaagttctgaagaagcagctggaggatgattgttactacattaacaggaggaaacggttagtgaaacttccatgccagaccaacatcataacgattttggaatcctatgtgaagcattttgctatcaatgcagccttttcagccaatgagaggcctcgtcaccatcacgttatgccacatgccaacatgaacgtgcattatatcccagcagaaaagaatgttgacctttgtaaggagatggtggatggattaagaataacctttgattacactctcccgttggttttactctatccatatgaacaagctcagtataaaaaggtgacttcgtctaaattttttcttccaattaaggaaagtgccacaagcactaacaggagccaggaggaactctctcccagtccgcctttgttgaatccatccacgccacagtccacagagagtcagccgaccaccggtgaaccagccacccccaaaaggcgcaaagctgagccagaagcattgcagtctctgaggcggtccacgcgccacagtgccaactgtgacaggctttctgagagcagcgcttcacctcagcccaagcgccggcagcaggacacatccgccagcatgcccaagctcttcctgcacctggaaaagaagacacctgtgcatagcagatcatcttcacctattcctctgactcctagcaaggaagggagtgctgtgtttgctggctttgaagggagaagaactaatgaaataaacgaggtcctctcctggaagcttgtgcctgacaattaccccccaggtgaccagccgcctccaccctcttacatttatggggcacaacatttgctgcgattgtttgtgaaacttccagaaatccttggaaagatgtccttttctgagaagaatctgaaggctttattgaagcactttgatctctttttgaggtttttagcagaataccacgatgacttcttcccagagtcggcttatgtcgctgcctgtgaggcacattacagcaccaagaacccccgggcaatttattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - prolyl 4-hydroxylase, alpha polypeptide II
- phosphodiesterase 1B, calmodulin-dependent
- zinc finger with KRAB and SCAN domains 4
- MUS81 endonuclease homolog (S. cerevisiae)

Buy MSL3-male-specific lethal 3 homolog (Drosophila) Gene now

Add to cart