Login to display prices
Login to display prices
PDE1B-phosphodiesterase 1B, calmodulin-dependent Gene View larger

PDE1B-phosphodiesterase 1B, calmodulin-dependent Gene

PTXBC032226

New product

Data sheet of PDE1B-phosphodiesterase 1B, calmodulin-dependent Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDE1B-phosphodiesterase 1B, calmodulin-dependent Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC032226
Product type: DNA & cDNA
Ncbi symbol: PDE1B
Origin species: Human
Product name: PDE1B-phosphodiesterase 1B, calmodulin-dependent Gene
Size: 2ug
Accessions: BC032226
Gene id: 5153
Gene description: phosphodiesterase 1B, calmodulin-dependent
Synonyms: presumed 63kDa form of the type 1 cyclic nucleotide phosphodiesterase family known as PDE1B; HEL-S-79p; PDE1B1; PDES1B; calcium/calmodulin-dependent 3',5'-cyclic nucleotide phosphodiesterase 1B; 63 kDa Cam-PDE; calcium/calmodulin-stimulated cyclic nucleotide phosphodiesterase; calmodulin-stimulated phosphodiesterase PDE1B1; cam-PDE 1B; epididymis secretory sperm binding protein Li 79p; phosphodiesterase 1B, calmodulin-dependent; phosphodiesterase 1B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctgtccccccgcagtcctccggagatgctggaggagtcggattgcccgtcacccctggagctgaagtcagcccccagcaagaagatgtggattaagcttcggtctctgctgcgctacatggtgaagcagttggagaatggggagataaacattgaggagctgaagaaaaatctggagtacacagcttctctgctggaagccgtctacatagatgagacacggcaaatcttggacacggaggacgagctgcaggagctgcggtcagatgccgtgccttcggaggtgcgggactggctggcctccaccttcacccagcaggcccgggccaaaggccgccgagcagaggagaagcccaagttccgaagcattgtgcacgctgtgcaggctgggatcttcgtggaacggatgttccggagaacatacacctctgtgggccccacttactctactgcggttctcaactgtctcaagaacctggatctctggtgctttgatgtcttttccttgaaccaggcagcagatgaccatgccctgaggaccattgtttttgagttgctgactcggcataacctcatcagccgcttcaagattcccactgtgtttttgatgagtttcctggatgccttggagacaggctatgggaagtacaagaatccttaccacaaccagatccacgcagccgatgttacccagacagtccattgcttcttgctccgcacagggatggtgcactgcctgtcggagattgagctcctggccatcatctttgctgcagctatccatgattatgagcacacgggcactaccaacagcttccacatccagaccaagtcagaatgtgccatcgtgtacaatgatcgttcagtgctggagaatcaccacatcagctctgttttccgattgatgcaggatgatgagatgaacattttcatcaacctcaccaaggatgagtttgtagaactccgagccctggtcattgagatggtgttggccacagacatgtcctgccatttccagcaagtgaagaccatgaagacagccttgcaacagctggagaggattgacaagcccaaggccctgtctctactgctccatgctgctgacatcagccacccaaccaagcagtggttggtccacagccgttggaccaaggccctcatggaggaattcttccgtcagggtgacaaggaggcagagttgggcctgcccttttctccactctgtgaccgcacttccactctagtggcacagtctcagatagggttcatcgacttcattgtggagcccacattctctgtgctgactgacgtggcagagaagagtgttcagcccctggcggatgaggactccaagtctaaaaaccagcccagctttcagtggcgccagccctctctggatgtggaagtgggagaccccaaccctgatgtggtcagctttcgttccacctgggtcaagcgcattcaggagaataagcagaaatggaaggaacgggcagcaagtggcatcaccaaccagatgtccattgacgagctgtccccctgtgaagaagaggcccccccatcccctgccgaagatgaacacaaccagaatgggaatctggattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger with KRAB and SCAN domains 4
- MUS81 endonuclease homolog (S. cerevisiae)
- synovial apoptosis inhibitor 1, synoviolin
- CREB regulated transcription coactivator 1