CORO2B-coronin, actin binding protein, 2B Gene View larger

CORO2B-coronin, actin binding protein, 2B Gene

PTXBC026335

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CORO2B-coronin, actin binding protein, 2B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CORO2B-coronin, actin binding protein, 2B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026335
Product type: DNA & cDNA
Ncbi symbol: CORO2B
Origin species: Human
Product name: CORO2B-coronin, actin binding protein, 2B Gene
Size: 2ug
Accessions: BC026335
Gene id: 10391
Gene description: coronin, actin binding protein, 2B
Synonyms: CLIPINC; coronin-2B; clipin C; coronin, actin binding protein, 2B; coronin-like protein C; coronin 2B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctggcgtccgcaataccgtagctccaagttccggaatgtctacgggaaggtggccaaccgggagcactgcttcgatgggatccccatcaccaagaatgtgcacgacaaccacttctgtgccgtcaacacccgcttcctggccatcgtcaccgagagcgcagggggcggctccttcctcgtcatccccctggagcagacaggcaggattgaacccaactaccccaaggtctgcggccaccagggcaatgtgctggatatcaaatggaaccccttcatcgacaacatcattgcctcgtgctcggaggacacgtcggtgcggatctgggagatccccgagggcgggctgaagcggaacatgacggaggcgctcctggagctgcacgggcacagccggcgtgtggggctggtcgagtggcaccccaccaccaacaacatcctgttcagcgctggctacgactacaaggtcctcatctggaacctggatgtgggtgagccggtgaagatgattgactgccacacggatgtgatcctctgcatgtccttcaacacggacggcagcctgctcaccaccacgtgcaaggacaagaagctgcgtgtgattgagccccgctctggccgtgttctgcaggaggccaactgcaaaaaccacagagtgaaccgggtggtgttcctggggaacatgaagcggctcgtcacgacaggggtctccaggtggaacacaagacagattgccctctgggaccaggaggacctctctatgcccctgatcgaagaggaaattgatgggctctctggcctcctgttccccttctatgatgctgacacccacatgctctacctggctggaaagggtgatggaaacatccggtactacgagatcagcactgagaagccctacctgagttacctcatggagttccgctccccagccccgcagaaaggcctaggggtcatgcccaagcacgggctggatgtgtcagcctgcgaggtgttccgcttctacaagctggtgactctcaagggcctgatcgagcccatctccatgatcgtgccccggaggtcagattcctaccaggaagacatttacccaatgacaccaggcacggagccagcactgaccccggatgaatggctgggaggcatcaaccgagatcccgtgctgatgtctttgaaagaaggctataagaagtcctcaaaaatggtatttaaggctcccatcaaagaaaagaagagtgttgtggtcaacggaatagatttattagaaaatgtcccacccaggacagagaatgagctccttcgaatgttcttccggcagcaggatgagattcgacggttgaaagaggagctggcccagaaggacatccgcattcggcagctccagctggaactgaaaaacttgcgcaacagccccaagaactgttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - FYN oncogene related to SRC, FGR, YES
- coronin, actin binding protein, 1B
- BAI1-associated protein 2-like 2
- polynucleotide kinase 3'-phosphatase

Buy CORO2B-coronin, actin binding protein, 2B Gene now

Add to cart