BAIAP2L2-BAI1-associated protein 2-like 2 Gene View larger

BAIAP2L2-BAI1-associated protein 2-like 2 Gene


New product

Data sheet of BAIAP2L2-BAI1-associated protein 2-like 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BAIAP2L2-BAI1-associated protein 2-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015619
Product type: DNA & cDNA
Ncbi symbol: BAIAP2L2
Origin species: Human
Product name: BAIAP2L2-BAI1-associated protein 2-like 2 Gene
Size: 2ug
Accessions: BC015619
Gene id: 80115
Gene description: BAI1-associated protein 2-like 2
Synonyms: brain-specific angiogenesis inhibitor 1-associated protein 2-like protein 2; BAI1-associated protein 2-like protein 2; pinkbar; planar intestinal- and kidney-specific BAR domain protein; BAI1 associated protein 2 like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccccgagatggaccagttctacaggtccaccatggccatctacaagagcatcatggagcagtttaaccccgccctggagaacctggtgtacctgggcaacaactacctgcgtgccttccacgctctgtccgaggcggccgaggtctacttcagtgccatccagaagattggggagcgtgccctgcagagccccacctcacagattctgggggagatcttggtgcagatgtctgacacccagcggcacttgaactctgacctggaggtggtggtgcagacattccatggaggcctgctgcagcacatggagaagaacaccaagctggacatgcagttcatcaaagacagccgccagcactatgagctcgagtaccgccaccgagcggccaacctggagaagtgcatgtctgagctgtggcgcatggagcgcaagagagacaagaacgtgcgggagatgaaggagagtgtgaaccggctgcacgcacagatgcaggccttcgtgtctgagagtcagcgggcggctgaattggaagagaagcggcgctatcgcttcctagcagagaagcacctgctactttccaacaccttcctgcagttcttcggccgggcccgggggatgctccagaaccgcgtgctgctgtggaaggagcagtctgaggccagccgcagcccgtcgcgcgcccactcccccggcctgctgggccccgcgctggggccgccctacccctcgggccgcctgacgcccacccgcctggacatgcccccgaggcccctgggagagttcagctccccccgcagccggcacggctccggctcctacggcaccgagcccgacgcgaggcccgcgtcccagctagagccagaccgtcgctccctgccccgcacgccgtcggcctcctcgctctacagcggcagcgcccaaagctcgcgctccaactcctttggcgagcgcccgggcggcggcgggggcgccaggagagtccgcgccctggtctcccactcggagggcgccaaccacacgctgctgcgcttctccgctggggacgtggtggaggtgttggtgcccgaggcccagaacggctggctctacggcaagctggagggctcgtccgcgagcggttggttccccgaggcgtacgtgaaggctctggaggaggggcccgtgaatcccatgacccccgtgacccccatgacctccatgacctccatgtcccccatgacacccatgacacccatgaaccccgggaacgagctgccttccaggtcctacccactccggggcagccacagcctcgatgacctcctggaccggccgggcaactccaccccaagccgggtgccaagccgtgcccccagccctgcacctccacccttgcccagcagccgccgcagcagcatgggcagcacagcagttgccactgacgtcaagaaactgatgtcctcagagcagtacccaccacaggagctcttcccgaggggcacaaatccttttgccactgtcaagcttcgtcccaccatcaccaatgaccgctcagcacccctcatccgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - polynucleotide kinase 3'-phosphatase
- hexosaminidase A (alpha polypeptide)
- regulator of G-protein signaling 14
- coiled-coil domain containing 116

Buy BAIAP2L2-BAI1-associated protein 2-like 2 Gene now

Add to cart