FYN-FYN oncogene related to SRC, FGR, YES Gene View larger

FYN-FYN oncogene related to SRC, FGR, YES Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FYN-FYN oncogene related to SRC, FGR, YES Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FYN-FYN oncogene related to SRC, FGR, YES Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032496
Product type: DNA & cDNA
Ncbi symbol: FYN
Origin species: Human
Product name: FYN-FYN oncogene related to SRC, FGR, YES Gene
Size: 2ug
Accessions: BC032496
Gene id: 2534
Gene description: FYN oncogene related to SRC, FGR, YES
Synonyms: FYN proto-oncogene, Src family tyrosine kinase; proto-oncogene c-Fyn; FYN oncogene related to SRC, FGR, YES; tyrosine-protein kinase Fyn; p59-FYN; SLK; SYN; OKT3-induced calcium influx regulator; c-syn protooncogene; proto-oncogene Syn; src-like kinase; src/yes-related novel; tyrosine kinase p59fyn(T)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctgtgtgcaatgtaaggataaagaagcaacaaaactgacggaggagagggacggcagcctgaaccagagctctgggtaccgctatggcacagaccccacccctcagcactaccccagcttcggtgtgacctccatccccaactacaacaacttccacgcagccgggggccaaggactcaccgtctttggaggtgtgaactcttcgtctcatacggggaccttgcgtacgagaggaggaacaggagtgacactctttgtggccctttatgactatgaagcacggacagaagatgacctgagttttcacaaaggagaaaaatttcaaatattgaacagctcggaaggagattggtgggaagcccgctccttgacaactggagagacaggttacattcccagcaattatgtggctccagttgactctatccaggcagaagagtggtactttggaaaacttggccgaaaagatgctgagcgacagctattgtcctttggaaacccaagaggtacctttcttatccgcgagagtgaaaccaccaaaggtgcctattcactttctatccgtgattgggatgatatgaaaggagaccatgtcaaacattataaaattcgcaaacttgacaatggtggatactacattaccacccgggcccagtttgaaacacttcagcagcttgtacaacattactcaggtacctggaatggaaacacaaaagtagccataaagactcttaaaccaggcacaatgtcccccgaatcattccttgaggaagcgcagatcatgaagaagctgaagcacgacaagctggtccagctctatgcagtggtgtctgaggagcccatctacatcgtcaccgagtatatgaacaaaggaagtttactggatttcttaaaagatggagaaggaagagctctgaaattaccaaatcttgtggacatggcagcacaggtggctgcaggaatggcttacatcgagcgcatgaattatatccatagagatctgcgatcagcaaacattctagtggggaatggactcatatgcaagattgctgacttcggattggcccgattgatagaagacaatgagtacacagcaagacaaggtgcaaagttccccatcaagtggacggcccccgaggcagccctgtacgggaggttcacaatcaagtctgacgtgtggtcttttggaatcttactcacagagctggtcaccaaaggaagagtgccatacccaggcatgaacaaccgggaggtgctggagcaggtggagcgaggctacaggatgccctgcccgcaggactgccccatctctctgcatgagctcatgatccactgctggaaaaaggaccctgaagaacgccccacttttgagtacttgcagagcttcctggaagactactttaccgcgacagagccccagtaccaacctggtgaaaacctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coronin, actin binding protein, 1B
- BAI1-associated protein 2-like 2
- polynucleotide kinase 3'-phosphatase
- hexosaminidase A (alpha polypeptide)

Buy FYN-FYN oncogene related to SRC, FGR, YES Gene now

Add to cart