Login to display prices
Login to display prices
HSPA13-heat shock protein 70kDa family, member 13 Gene View larger

HSPA13-heat shock protein 70kDa family, member 13 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSPA13-heat shock protein 70kDa family, member 13 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HSPA13-heat shock protein 70kDa family, member 13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036370
Product type: DNA & cDNA
Ncbi symbol: HSPA13
Origin species: Human
Product name: HSPA13-heat shock protein 70kDa family, member 13 Gene
Size: 2ug
Accessions: BC036370
Gene id: 6782
Gene description: heat shock protein 70kDa family, member 13
Synonyms: STCH; heat shock 70 kDa protein 13; heat shock protein 70kDa family, member 13; microsomal stress 70 protein ATPase core; stress 70 protein chaperone, microsome-associated, 60kD; stress 70 protein chaperone, microsome-associated, 60kDa; stress-70 protein chaperone microsome-associated 60 kDa protein; testis secretory sperm-binding protein Li 199a; heat shock protein family A (Hsp70) member 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccagagagatgacgatcttaggatcggctgttttgactctcctgttggccggctatttggcacaacagtatttaccattgcctactcctaaagtgattggtattgatcttggcaccacctattgttctgttggggtgttttttcctggcacaggaaaagtaaaggtgattccagatgaaaatgggcatatcagcatacccagcatggtgtcttttactgacaatgatgtatatgtgggatatgaaagcgtagagctggcagattcaaatcctcaaaacacaatatatgatgccaaaagattcataggcaagatttttaccgcagaagagttggaggctgaaattggcagatacccatttaaggttttaaacaaaaatggaatggttgagttttctgtgacaagtaatgagaccatcacagtgtccccagaatatgttggctctcgactattgttgaagttaaaggaaatggcagaggcatatcttggaatgccagttgccaatgctgtcatttctgtaccagcagaatttgatctaaaacagagaaattcaacaattgaagctgctaaccttgcaggactgaagattttgagggtaataaatgaacccacagcagcagctatggcctatggtctccacaaggctgacgtcttccacgtcttggtgatagacttgggcggaggaactctagatgtgtctttactgaataaacaaggagggatgtttctaacccgagcaatgtctggaaacaataaacttggaggacaggacttcaatcagagattgcttcagtacttatataaacagatctatcaaacatatggcttcgtgccctctaggaaagaggaaatccacagattgagacaagctgtggaaatggtcaaattaaatctgactcttcatcaatctgctcagttgtcagtattactaacggtggaggagcaggacaggaaggaacctcacagtagtgacactgaactgccaaaagacaaactttcctcagcagatgaccatcgcgtgaacagtgggtttggacgtggcctttctgataagaaaagtggagaaagtcaggttttatttgaaacagaaatatcacggaaactctttgatacccttaatgaagacctctttcagaaaatactggtacccattcagcaagtattgaaagaaggccacctggaaaagactgagattgatgaggtggttttagttgggggctccactcgtattcctcggatccgtcaagtcattcaagagttctttggaaaagatcccaacacatctgtagaccctgacctagcagtagtaacgggagtggctatccaagcagggattgatggaggcttttggcctctccaagtcagtgctttagaaattcccaataagcatttacaaaaaaccaacttcaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serine hydroxymethyltransferase 1 (soluble)
- acyl-Coenzyme A binding domain containing 5
- transforming growth factor beta regulator 4
- neuroblastoma breakpoint family, member 15