Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HSPA13-heat shock protein 70kDa family, member 13 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HSPA13-heat shock protein 70kDa family, member 13 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036370 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HSPA13 |
| Origin species: | Human |
| Product name: | HSPA13-heat shock protein 70kDa family, member 13 Gene |
| Size: | 2ug |
| Accessions: | BC036370 |
| Gene id: | 6782 |
| Gene description: | heat shock protein 70kDa family, member 13 |
| Synonyms: | STCH; heat shock 70 kDa protein 13; heat shock protein 70kDa family, member 13; microsomal stress 70 protein ATPase core; stress 70 protein chaperone, microsome-associated, 60kD; stress 70 protein chaperone, microsome-associated, 60kDa; stress-70 protein chaperone microsome-associated 60 kDa protein; testis secretory sperm-binding protein Li 199a; heat shock protein family A (Hsp70) member 13 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccagagagatgacgatcttaggatcggctgttttgactctcctgttggccggctatttggcacaacagtatttaccattgcctactcctaaagtgattggtattgatcttggcaccacctattgttctgttggggtgttttttcctggcacaggaaaagtaaaggtgattccagatgaaaatgggcatatcagcatacccagcatggtgtcttttactgacaatgatgtatatgtgggatatgaaagcgtagagctggcagattcaaatcctcaaaacacaatatatgatgccaaaagattcataggcaagatttttaccgcagaagagttggaggctgaaattggcagatacccatttaaggttttaaacaaaaatggaatggttgagttttctgtgacaagtaatgagaccatcacagtgtccccagaatatgttggctctcgactattgttgaagttaaaggaaatggcagaggcatatcttggaatgccagttgccaatgctgtcatttctgtaccagcagaatttgatctaaaacagagaaattcaacaattgaagctgctaaccttgcaggactgaagattttgagggtaataaatgaacccacagcagcagctatggcctatggtctccacaaggctgacgtcttccacgtcttggtgatagacttgggcggaggaactctagatgtgtctttactgaataaacaaggagggatgtttctaacccgagcaatgtctggaaacaataaacttggaggacaggacttcaatcagagattgcttcagtacttatataaacagatctatcaaacatatggcttcgtgccctctaggaaagaggaaatccacagattgagacaagctgtggaaatggtcaaattaaatctgactcttcatcaatctgctcagttgtcagtattactaacggtggaggagcaggacaggaaggaacctcacagtagtgacactgaactgccaaaagacaaactttcctcagcagatgaccatcgcgtgaacagtgggtttggacgtggcctttctgataagaaaagtggagaaagtcaggttttatttgaaacagaaatatcacggaaactctttgatacccttaatgaagacctctttcagaaaatactggtacccattcagcaagtattgaaagaaggccacctggaaaagactgagattgatgaggtggttttagttgggggctccactcgtattcctcggatccgtcaagtcattcaagagttctttggaaaagatcccaacacatctgtagaccctgacctagcagtagtaacgggagtggctatccaagcagggattgatggaggcttttggcctctccaagtcagtgctttagaaattcccaataagcatttacaaaaaaccaacttcaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serine hydroxymethyltransferase 1 (soluble) - acyl-Coenzyme A binding domain containing 5 - transforming growth factor beta regulator 4 - neuroblastoma breakpoint family, member 15 |