ACBD5-acyl-Coenzyme A binding domain containing 5 Gene View larger

ACBD5-acyl-Coenzyme A binding domain containing 5 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACBD5-acyl-Coenzyme A binding domain containing 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACBD5-acyl-Coenzyme A binding domain containing 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030555
Product type: DNA & cDNA
Ncbi symbol: ACBD5
Origin species: Human
Product name: ACBD5-acyl-Coenzyme A binding domain containing 5 Gene
Size: 2ug
Accessions: BC030555
Gene id: 91452
Gene description: acyl-Coenzyme A binding domain containing 5
Synonyms: acyl-CoA-binding domain-containing protein 5; acyl-Coenzyme A binding domain containing 5; endozepine-related protein; membrane-associated diazepam binding inhibitor; acyl-CoA binding domain containing 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggacacgagatccgtgcacgagactaggtttgaggcggccgtgaaggtgatccagagtttgccgaagaatggttcattccagccaacaaatgaaatgatgcttaaattttatagcttctataagcaggcaactgaaggaccctgtaaactttcaaggcctggattttgggatcctattggaagatataaatgggatgcttggagttcactgggtgatatgaccaaagaggaagccatgattgcatatgttgaagaaatgaaaaagattattgaaactatgccaatgactgagaaagttgaagaattgctgcgtgtcataggtccattttatgaaattgtcgaggacaaaaagagtggcaggagttctgatataacctcagatcttggtaatgttctcacttctactccgaacgccaaaaccgttaatggtaaagctgaaagcagtgacagtggagccgagtctgaggaagaagaggcccaagaagaagtgaaaggagcagaacaaagtgataatgataagaaaatgatgaagaagtcagcagaccataagaatttggaagtcattgtcactaatggctatgataaagatggctttgttcaggatatacagaatgacattcatgccagttcttccctgaatggcagaagcactgaagaagtaaagcccattgatgaaaacttggggcaaactggaaaatctgctgtttgcattcaccaagatataaatgatgatcatgttgaagatgttacaggaattcagcatttgacaagcgattcagacagtgaagtttactgtgattctatggaacaatttggacaagaagagtctttagacagctttacgtccaacaatggaccatttcagtattacttgggtggtcattccagtcaacccatggaaaattctggatttcgtgaagatattcaagtacctcctggaaatggcaacattgggaatatgcaggtggttgcagttgaaggaaaaggtgaagtcaagcatggaggagaagatggcaggaataacagcggagcaccacaccgggagaagcgaggcggagaaactgacgaattctctaatgttagaagaggaagaggacataggatgcaacacttgagcgaaggaaccaagggccggcaggtgggaagtggaggtgatggggagcgctggggctccgacagagggtcccgaggcagcctcaatgagcagatcgccctcgtgctgatgagactgcaggaggacatgcagaatgtccttcagagactgcagaaactggaaacgctgactgctttgcaggcaaaatcatcaacatcaacattgcagactgctcctcagcccacctcacagagaccatcttggtggcccttcgagatgtctcctggtgtgctaacgtttgccatcatatggccttttattgcacagtggttggtgtatttatactatcaaagaaggagaagaaaactgaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transforming growth factor beta regulator 4
- neuroblastoma breakpoint family, member 15
- cirrhosis, autosomal recessive 1A (cirhin)
- FtsJ methyltransferase domain containing 1

Buy ACBD5-acyl-Coenzyme A binding domain containing 5 Gene now

Add to cart