SHMT1-serine hydroxymethyltransferase 1 (soluble) Gene View larger

SHMT1-serine hydroxymethyltransferase 1 (soluble) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SHMT1-serine hydroxymethyltransferase 1 (soluble) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SHMT1-serine hydroxymethyltransferase 1 (soluble) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007979
Product type: DNA & cDNA
Ncbi symbol: SHMT1
Origin species: Human
Product name: SHMT1-serine hydroxymethyltransferase 1 (soluble) Gene
Size: 2ug
Accessions: BC007979
Gene id: 6470
Gene description: serine hydroxymethyltransferase 1 (soluble)
Synonyms: CSHMT; SHMT; serine hydroxymethyltransferase, cytosolic; cytoplasmic serine hydroxymethyltransferase; glycine hydroxymethyltransferase; serine hydroxymethyltransferase 1 (soluble); serine methylase; serine hydroxymethyltransferase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgatgccagtcaacggggcccacaaggatgctgacctgtggtcctcacatgacaagatgctggcacaacccctcaaagacagtgatgttgaggtttacaacatcattaagaaggagagtaaccggcagagggttggattggagctgattgcctcggagaatttcgccagccgagcagttttggaggccctaggctcttgcttaaataacaaatactctgaggggtacccgggccagagatactatggcgggactgagtttattgatgaactggagaccctctgtcagaagcgagccctgcaggcctataagctggacccacagtgctggggggtcaacgtccagccctactcaggctcccctgcaaactttgctgtgtacactgccctggtggaaccccatgggcgcatcatgggcctggaccttccggatgggggccacctgacccatgggttcatgacagacaagaagaaaatctctgccacgtccatcttctttgaatctatgccctacaaggtgaacccagatactggctacatcaactatgaccagctggaggagaacgcacgcctcttccacccgaagctgatcatcgcaggaaccagctgctactcccgaaacctggaatatgcccggctacggaagattgcagatgagaacggggcgtatctcatggcggacatggctcacatcagcgggctggtggcggctggcgtggtgccctccccatttgaacactgccatgtggtgaccaccaccactcacaagaccctgcgaggctgccgagctggcatgatcttctacaggaaaggagtgaaaagtgtggatcccaagactggcaaagagattctgtacaacctggagtctcttatcaattctgctgtgttccctggcctgcagggaggtccccacaaccacgccattgctggggttgctgtggcactgaagcaagctatgactctggaatttaaagtttatcaacaccaggtggtggccaactgcagggctctgtctgaggccctgacggagctgggctacaaaatagtcacaggtggttctgacaaccatttgatccttgtggatctccgttccaaaggcacagatggtggaagggctgagaaggtgctagaagcctgttctattgcctgcaacaagaacacctgtccaggtgacagaagcgctctgcggcccagtggactgcggctggggaccccagcactgacgtcccgtggacttttggaaaaagacttccaaaaagtagcccactttattcacagagggatagagctgaccctgcagatccagagcgacactggtgtcagagccaccctgaaagagttcaaggagagactggcaggggataagtaccaggcggccgtgcaggctctccgggaggaggttgagagcttcgcctctttcttccctctgcctggcctgcctgacttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acyl-Coenzyme A binding domain containing 5
- transforming growth factor beta regulator 4
- neuroblastoma breakpoint family, member 15
- cirrhosis, autosomal recessive 1A (cirhin)

Buy SHMT1-serine hydroxymethyltransferase 1 (soluble) Gene now

Add to cart