Login to display prices
Login to display prices
L2HGDH-L-2-hydroxyglutarate dehydrogenase Gene View larger

L2HGDH-L-2-hydroxyglutarate dehydrogenase Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of L2HGDH-L-2-hydroxyglutarate dehydrogenase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about L2HGDH-L-2-hydroxyglutarate dehydrogenase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006117
Product type: DNA & cDNA
Ncbi symbol: L2HGDH
Origin species: Human
Product name: L2HGDH-L-2-hydroxyglutarate dehydrogenase Gene
Size: 2ug
Accessions: BC006117
Gene id: 79944
Gene description: L-2-hydroxyglutarate dehydrogenase
Synonyms: C14orf160; L2HGA; L-2-hydroxyglutarate dehydrogenase, mitochondrial; 2-hydroxyglutarate dehydrogenase; L-alpha-hydroxyglutarate dehydrogenase; alpha-hydroxyglutarate oxidoreductase; alpha-ketoglutarate reductase; duranin; L-2-hydroxyglutarate dehydrogenase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgccagcgctgcgttatttggttggtgcctgcggacgggcccgcgggcgtttcgccggtggctcccctggggcgtgcgggttcgcgtctgggaggccaagaccgctgtgtggaggtagccgcagcgccagcaccagctcatttgatatagtcattgttggtggcggaattgtggggcttgcctctgccagagcactcatcctgcgacatccatcactttctattggtgttctggaaaaggagaaagatttagctgttcaccagactggacataacagtggtgtcatacatagtggaatttattataaacctgagtctctgaaagccaaattatgtgtacaaggtgcagccctcctctatgagtactgtcagcaaaagggaatttcctacaagcagtgtggcaagcttatagtagctgttgaacaagaagaaattcccagacttcaggccctatatgagaaaggcctccagaatggtgtcccgggcctgaggctgatccagcaggaggatataaaaaagaaggagccatattgtaggggtctaatggctattgattgtccacatactggcattgtggactatcggcaggtggctttgtcatttgcccaggatttccaagaagcaggtggctctgtcttgaccaattttgaagtaaaaggtattgaaatggctaaagaaagtccttcaagaagtatagatggaatgcaatatccaattgttataaagaatacaaagggagaggaaattcgatgtcagtatgttgtgacatgtgcaggactttactcagaccgtatttcagagttgagtggctgcactcctgatcctcgaattgtaccattccggggagattacctgcttttgaagccagaaaaatgttatcttgtaaaaggaaatatttatccggtcccagatagccggtttcctttcctaggagttcacttcacaccaaggatggatggcagtatttggctagggcctaatgcagttcttgcctttaaacgagagggttacagaccctttgacttcagtgccacagatgttatggatataattatcaatagtggcttgattaaactggcatcccagaatttttcctatggagttactgaaatgtataaagcatgttttcttggtgcaacagtgaagtatcttcaaaaattcatccctgaaattactatcagtgatatacttaggcaggtggctgtgagaggaccgagctggctatggcagcaacccatgaaagtgagtgataacaacatttattgtttcctgtggcgttgctttgctttgctattgactggtagcacttgtagctttaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 112
- coronin, actin binding protein, 2B
- FYN oncogene related to SRC, FGR, YES
- coronin, actin binding protein, 1B