Login to display prices
Login to display prices
NUSAP1-nucleolar and spindle associated protein 1 Gene View larger

NUSAP1-nucleolar and spindle associated protein 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUSAP1-nucleolar and spindle associated protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NUSAP1-nucleolar and spindle associated protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001308
Product type: DNA & cDNA
Ncbi symbol: NUSAP1
Origin species: Human
Product name: NUSAP1-nucleolar and spindle associated protein 1 Gene
Size: 2ug
Accessions: BC001308
Gene id: 51203
Gene description: nucleolar and spindle associated protein 1
Synonyms: ANKT; BM037; LNP; NUSAP; PRO0310p1; Q0310; SAPL; nucleolar and spindle-associated protein 1; nucleolar protein ANKT; nucleolar and spindle associated protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatcatcccctctctagaggagctggactccctcaagtacagtgacctgcagaacttagccaagagtctgggtctccgggccaacctgagggcaaccaagttgttaaaagccttgaaaggctacattaaacatgaggcaagaaaaggaaatgagaatcaggatgaaagtcaaacttctgcatcctcttgtgatgagactgagatacagatcagcaaccaggaagaagctgagagacagccacttggccatgtcaccaaaacaaggagaaggtgcaagactgtccgtgtggaccctgactcacagcagaatcattcagagataaaaataagtaatcccactgaattccagaatcatgaaaagcaggaaagccaggatctcagagctactgcaaaagttccttctccaccagacgagcaccaagaagctgagaatgctgtttcctcaggtaacagagattcaaaggtaccttcagaaggaaagaaatctctctacacagatgagtcatccaaacctggaaaaaataaaagaactgcaatcactactccaaactttaagaagcttcatgaagctcattttaaggaaatggagtccattgatcaatatattgagagaaaaaagaaacattttgaagaacacaattccatgaatgaactgaagcagcccatcaataagggaggggtcaggactccagtacctccaagaggaagactctctgtggcttctactcccatcagccaacgacgctcgcaaggccggtcttgtggccctgcaagtcagagtaccttgggtctgaaggggtcactcaagcgctctgctatctctgcagctaaaacgggtgtcaggttttcagctgctactaaagataatgagcataagcgttcactgaccaagactccagccagaaagtctgcacatgtgaccgtgtctgggggcaccccaaaaggcgaggctgtgcttgggacacacaaattaaagaccatcacggggaattctgctgctgttattaccccattcaagttgacaactgaggcaacgcagactccagtctccaataagaaaccagtgtttgatcttaaagcaagtttgtctcgtcccctcaactatgaaccacacaaaggaaagctaaaaccatgggggcaatctaaagaaaataattatctaaatcaacatgtcaacagaattaacttctacaagaaaacttacaaacaaccccatctccagacaaaggaagagcaacggaagaaacgcgagcaagaacgaaaggagaagaaagcaaaggttttgggaatgcgaaggggcctcattttggctgaagattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - methyltransferase 11 domain containing 1
- aldehyde dehydrogenase 3 family, memberA1
- heat shock protein 70kDa family, member 13
- serine hydroxymethyltransferase 1 (soluble)