MGC42105-serine/threonine-protein kinase NIM1 Gene View larger

MGC42105-serine/threonine-protein kinase NIM1 Gene

PTXBC036422

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC42105-serine/threonine-protein kinase NIM1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC42105-serine/threonine-protein kinase NIM1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036422
Product type: DNA & cDNA
Ncbi symbol: MGC42105
Origin species: Human
Product name: MGC42105-serine/threonine-protein kinase NIM1 Gene
Size: 2ug
Accessions: BC036422
Gene id: 167359
Gene description: serine/threonine-protein kinase NIM1
Synonyms: NIM1; serine/threonine-protein kinase NIM1; NIM1 serine/threonine protein kinase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgcagtgtatatgaatggaggtggcctggtgaacccccattatgcccggtgggatcggcgcgacagtgtagaaagtggctgtcagaccgagagtagcaaggagggtgaggagggacagccccgccagctgacgcccttcgagaaactgacacaggacatgtcccaggatgagaaggtggtgagggagatcacgctggggaaacggataggcttctaccgaattcgaggggaaatcggaagtggaaacttctcccaagtgaagcttgggattcactccctaaccaaagaaaaggtggccattaagatcctggacaagaccaagttagaccagaaaacccagaggctactatcccgagaaatctccagcatggaaaagctgcaccatcccaacatcatccgcctttacgaagtggtggagaccctatccaagctgcacttggtgatggagtatgcagggggtggggagctcttcggaaaaattagcactgaggggaagctctctgaaccagaaagcaagctcatcttctcccagattgtgtctgccgtgaagcacatgcatgaaaaccaaattattcatagagatctgaaagcagaaaatgtattctataccagtaatacttgtgtgaaggtgggcgattttggattcagcacagtaagcaaaaaaggtgaaatgctgaacactttctgtgggtctcctccctacgctgcgcctgaactcttccgggacgagcactacatcggcatttacgtggatatctgggccttgggggtgcttttgtacttcatggtgactggcaccatgccatttcgggcagaaaccgtggccaaactaaaaaagagcatcctcgagggcacatacagtgtaccgccgcacgtgtcagagccctgccaccgactcatccgaggagtccttcagcagatccccacggagaggtacggaatcgactgcatcatgaatgatgaatggatgcaaggggtgccataccctacacctttggaacctttccaactggatcccaaacatttgtcggaaaccagcactctcaaggaagaagaaaatgaggtcaaaagcactttagaacatttgggcattacagaagagcatattcgaaataaccaagggagagatgctcgcagctcaatcacaggggtctatagaattattttacatagagtccaaaggaagaaggctttggaaagtgtcccagtcatgatgctaccagaccctaaagaaagagacctcaaaaaagggtcccgtgtctacagagggataagacacacatccaaattttgctcgattttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pyruvate dehydrogenase kinase, isozyme 1
- F-box and WD repeat domain containing 2
- nuclear factor, interleukin 3 regulated
- U2 small nuclear RNA auxiliary factor 2

Buy MGC42105-serine/threonine-protein kinase NIM1 Gene now

Add to cart