PDK1-pyruvate dehydrogenase kinase, isozyme 1 Gene View larger

PDK1-pyruvate dehydrogenase kinase, isozyme 1 Gene

PTXBC039158

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDK1-pyruvate dehydrogenase kinase, isozyme 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDK1-pyruvate dehydrogenase kinase, isozyme 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC039158
Product type: DNA & cDNA
Ncbi symbol: PDK1
Origin species: Human
Product name: PDK1-pyruvate dehydrogenase kinase, isozyme 1 Gene
Size: 2ug
Accessions: BC039158
Gene id: 5163
Gene description: pyruvate dehydrogenase kinase, isozyme 1
Synonyms: [Pyruvate dehydrogenase (acetyl-transferring)] kinase isozyme 1, mitochondrial; PDH kinase 1; mitochondrial pyruvate dehydrogenase, lipoamide, kinase isoenzyme 1; pyruvate dehydrogenase kinase, isoenzyme 1; pyruvate dehydrogenase kinase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggctggcgcggctgcttcgcggagccgccttggccggcccgggcccggggctgcgcgccgccggcttcagccgcagcttcagctcggactcgggctccagcccggcgtccgagcgcggcgttccgggccaggtggacttctacgcgcgcttctcgccgtccccgctctccatgaagcagttcctggacttcggatcagtgaatgcttgtgaaaagacctcatttatgtttctgcggcaagagttgcctgtcagactggcaaatataatgaaagaaataagtctccttccagataatcttctcaggacaccatccgttcaattggtacaaagctggtatatccagagtcttcaggagcttcttgattttaaggacaaaagtgctgaggatgctaaagctatttatgactttacagatactgtgatacggatcagaaaccgacacaatgatgtcattcccacaatggcccagggtgtgattgaatacaaggagagctttggggtggatcctgtcaccagccagaatgttcagtactttttggatcgattctacatgagtcgcatttcaattagaatgttactcaatcagcactctttattgtttggtggaaaaggcaaaggaagtccatctcatcgaaaacacattggaagcataaatccaaactgcaatgtacttgaagttattaaagatggctatgaaaatgctaggcgtctgtgtgatttgtattatattaactctcccgaactagaacttgaagaactaaatgcaaaatcaccaggacagccaatacaagtggtttatgtaccatcccatctctatcacatggtgtttgaacttttcaagaatgcaatgagagccactatggaacaccatgccaacagaggtgtttacccccctattcaagttcatgtcacgctgggtaatgaggatttgactgtgaagatgagtgaccgaggaggtggcgttcctttgaggaaaattgacagacttttcaactacatgtattcaactgcaccaagacctcgtgttgagacctcccgcgcagtgcctctggctggttttggttatggattgcccatatcacgtctttacgcacaatacttccaaggagacctgaagctgtattccctagagggttacgggacagatgcagttatctacattaaggctctgtcaacagactcaatagaaagactcccagtgtataacaaagctgcctggaagcattacaacaccaaccacgaggctgatgactggtgcgtccccagcagagaacccaaagacatgacgacgttccgcagtgcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - F-box and WD repeat domain containing 2
- nuclear factor, interleukin 3 regulated
- U2 small nuclear RNA auxiliary factor 2
- GATA zinc finger domain containing 2A

Buy PDK1-pyruvate dehydrogenase kinase, isozyme 1 Gene now

Add to cart