Login to display prices
Login to display prices
U2AF2-U2 small nuclear RNA auxiliary factor 2 Gene View larger

U2AF2-U2 small nuclear RNA auxiliary factor 2 Gene

PTXBC008740

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of U2AF2-U2 small nuclear RNA auxiliary factor 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about U2AF2-U2 small nuclear RNA auxiliary factor 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008740
Product type: DNA & cDNA
Ncbi symbol: U2AF2
Origin species: Human
Product name: U2AF2-U2 small nuclear RNA auxiliary factor 2 Gene
Size: 2ug
Accessions: BC008740
Gene id: 11338
Gene description: U2 small nuclear RNA auxiliary factor 2
Synonyms: U2AF65; splicing factor U2AF 65 kDa subunit; U2 (RNU2) small nuclear RNA auxiliary factor 2; U2 auxiliary factor 65 kDa subunit; U2 small nuclear ribonucleoprotein auxiliary factor (65kD); U2 snRNP auxiliary factor large subunit; hU2AF65; U2 small nuclear RNA auxiliary factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggacttcgacgagttcgagcggcagctcaacgagaataaacaagagcgggacaaggagaaccggcatcggaagcgcagccacagccgctctcggagccgggaccgcaaacgccggagccggagccgcgaccggcgcaaccgggaccagcggagcgcctcccgggacaggcgacgacgcagcaaacctttgaccagaggcgctaaagaggagcacggtggactgattcgttccccccgccacgagaagaagaagaaggtccgtaaatactgggacgtgccacccccaggctttgagcacatcaccccaatgcagtacaaggccatgcaagctgcgggtcagattccagccactgctcttctccccaccatgacccctgacggtctggctgtgaccccaacgccggtgcccgtggtcgggagccagatgaccagacaagcccggcgcctctacgtgggcaacatcccctttggcatcactgaggaggccatgatggatttcttcaacgcccagatgcgcctgggggggctgacccaggcccctggcaacccagtgttggctgtgcagattaaccaggacaagaattttgcctttttggagttccgctcagtggacgagactacccaggctatggcctttgatggcatcatcttccagggccagtcactaaagatccgcaggcctcacgactaccagccgcttcctggcatgtcagagaacccctccgtctatgtgcctggggttgtgtccactgtggtccccgactctgcccacaagctgttcatcgggggcttacccaactacctgaacgatgaccaggtcaaagagctgctgacatcctttgggcccctcaaggccttcaacctggtcaaggacagtgccacggggctctccaagggctacgccttctgtgagtacgtggacatcaacgtcacggatcaggccattgcggggctgaacggcatgcagctgggggataagaagctgctggtccagagggcgagtgtgggagccaagaatgccacgctgagcaccatcaatcagacgcctgtgaccctgcaagtgccgggcttgatgagctcccaggtgcagatgggcggccacccgactgaggtcctgtgcctcatgaacatggtgctgcctgaggagctgctggacgacgaggagtatgaggagatcgtggaggatgtgcgggacgagtgcagcaagtacgggcttgtcaagtccatcgagatcccccggcctgtggacggcgtcgaggtgcccggctgcggaaagatctttgtggagttcacctctgtgtttgactgccagaaagccatgcagggcctgacgggccgcaagttcgccaacagagtggttgtcacaaaatactgtgaccccgactcttatcaccgccgggacttctggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GATA zinc finger domain containing 2A
- splicing factor, arginine/serine-rich 4
- t-complex-associated-testis-expressed 1
- Fanconi anemia, complementation group C