ZSCAN20-zinc finger and SCAN domain containing 20 Gene View larger

ZSCAN20-zinc finger and SCAN domain containing 20 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZSCAN20-zinc finger and SCAN domain containing 20 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZSCAN20-zinc finger and SCAN domain containing 20 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011404
Product type: DNA & cDNA
Ncbi symbol: ZSCAN20
Origin species: Human
Product name: ZSCAN20-zinc finger and SCAN domain containing 20 Gene
Size: 2ug
Accessions: BC011404
Gene id: 7579
Gene description: zinc finger and SCAN domain containing 20
Synonyms: KOX29; ZFP-31; ZNF31; ZNF360; zinc finger and SCAN domain-containing protein 20; zinc finger protein 31; zinc finger protein 360; zinc finger protein KOX29; zinc finger and SCAN domain containing 20
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctatggccctggaattgcaagcccaggcatctccgcagccagagcctgaagaactcctgattgtgaaactggaagaggactcttggggatcagaatccaaactctgggagaaggaccgtggctctgtctctggcccagaggcctcccgccagcgcttcaggcaattccaatacagggatgcagctggaccccacgaggccttcagccagctctgggctctctgctgtcgttggctgaggccggagatccgtctcaaagagcagatcctggagctgctcgtgctggagcagttcctgactatcttgcctagggaggtccagacctgggtgcaggcacgccaccctgagagtggtgaggaggctgtggccttggtggaggattggcaccgagagaccaggactgcaggacagtcgggactggaattgcatacagaagagaccaggcccttaaagacaggggaagaagctcagagcttccagctgcagccagtggatccctggcctgagggacagtcccagaagaagggggtgaagaatacatgccctgaccttcccaatcacctaaatgccgaggtggcaccacagcctttgaaagagagtggagttccagtttcaaaaccaagtaatacctccgagaaagagcaaggaccagagttttggggtctaagtcttataaattctgggaaaaggagcactgcagattacagcctggataatgagccagctcaggcattgacctggagggattcaagagcctgggaggaacaataccagtgggatgtggaggacatgaaggtgtcaggtgttcactggggctatgaggagaccaagactttcctggcaattttgagtgaatctcctttctctgaaaagctccggacttgtcaccagaaccgccaggtatatcgggccattgcagagcagctaagggcaaggggcttcctgcggacactggagcaatgtcgctatagggtcaaaaacctcctacggaattaccggaaagccaagagcagccacccaccaggtacctgccccttctatgaggagctggaggccctggtcagggctcggacagccatcagagccacagatggcccaggagaggccgtggcacttcccaggctcggggatagtgacgcagagatggatgagcaggaggaagggggctgggatcctgaagaaatggcagaagactgtaacggtgctggcctggtcaatgttgagtctacccaggggcccaggattgcaggggccccagctctgttccagagtcgtattggtaagaacatgggggtttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nucleolar and spindle associated protein 1
- methyltransferase 11 domain containing 1
- aldehyde dehydrogenase 3 family, memberA1
- heat shock protein 70kDa family, member 13

Buy ZSCAN20-zinc finger and SCAN domain containing 20 Gene now

Add to cart