C3orf58-chromosome 3 open reading frame 58 Gene View larger

C3orf58-chromosome 3 open reading frame 58 Gene

PTXBC037293

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C3orf58-chromosome 3 open reading frame 58 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C3orf58-chromosome 3 open reading frame 58 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC037293
Product type: DNA & cDNA
Ncbi symbol: C3orf58
Origin species: Human
Product name: C3orf58-chromosome 3 open reading frame 58 Gene
Size: 2ug
Accessions: BC037293
Gene id: 205428
Gene description: chromosome 3 open reading frame 58
Synonyms: UPF0672 protein C3orf58; DIA1; GoPro49; HASF; deleted in autism protein 1; Golgi Protein of 49 kDa; Golgi protein GoPro49; deleted in autism 1; hypoxia and AKT-induced stem cell factor; hypoxia and Akt induced stem cell factor; chromosome 3 open reading frame 58
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggcgcctggtgcccccgaagctgggccgcctgtcccgctcgctgaagctggcggcgctgggcagcctgttggtgctgatggtgctgcactcgccgtcgctgctcgcctcttggcagcgcaacgaactgaccgaccggcgcttcctgcagctcaataagtgcccggcgtgcttcggcacgagctggtgccgccgcttcctcaacgggcaggtggtattcgaggcgtggggccgcttgcgcctgctggacttcctcaacgtgaagaacgtgtacttcgcgcagtacggcgagccccgcgagggcggccgccgccgagtggtgctcaagcgcctcggctcgcagcgcgagctggcgcagctcgaccagagcatctgcaagcgggccaccggccggccccgctgcgacctgctgcaggccatgccccggaccgagttcgcgcgcctcaacggcgacgtgcgtctgctcacgcccgaggcggtggagggctggtcggacctggtgcactgcccctcgcagcgccttctcgaccgcctggtgcgccgctacgcggagaccaaggactcgggcagcttcctgcttcgcaacctcaaggactcggagcgcatgcagctgctgctgaccctggccttcaaccccgagccgctggtgctacagagttttccgtctgatgaaggttggccatttgcaaagtatcttggagcttgtggaagaatggtggctgtaaattatgttggagaagaactgtggagttactttaatgcgccatgggaaaaacgagttgacctcgcttggcaattaatggaaatagcagaacagcttacaaacaatgactttgaatttgcactctacctcctggacgtcagctttgacaattttgcagttggtcctagagatgggaaggtaatcattgtggatgctgaaaatgttttggttgctgacaaaagattaattagacaaaataaacctgaaaattgggatgtatggtatgaaagcaagtttgatgactgtgataaggaggcttgcttatcattttcaaaagaaattctttgtgctcgtgccactgtggaccacaattactatgctgtttgtcagaacctcttatccagacatgccacctggcgtggcacttctggaggactccttcatgatccaccaagtgaaattgccaaagatggccggctcgaggccttgctggatgagtgtgccaacccaaagaagcgctatggcagattccaggctgcaaaagaactgcgtgaatacctagcacaattaagtaacaacgtgaggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger CCCH-type containing 10
- peptidyl arginine deiminase, type II
- mitochondrial ribosomal protein S30
- 3-oxoacyl-ACP synthase, mitochondrial

Buy C3orf58-chromosome 3 open reading frame 58 Gene now

Add to cart