PADI2-peptidyl arginine deiminase, type II Gene View larger

PADI2-peptidyl arginine deiminase, type II Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PADI2-peptidyl arginine deiminase, type II Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PADI2-peptidyl arginine deiminase, type II Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009701
Product type: DNA & cDNA
Ncbi symbol: PADI2
Origin species: Human
Product name: PADI2-peptidyl arginine deiminase, type II Gene
Size: 2ug
Accessions: BC009701
Gene id: 11240
Gene description: peptidyl arginine deiminase, type II
Synonyms: PAD-H19; PAD2; PDI2; protein-arginine deiminase type-2; peptidyl arginine deiminase, type II; protein-arginine deiminase type II; peptidyl arginine deiminase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgcgcgagcggaccgtgcggctgcagtacgggagccgcgtggaggcggtgtacgtgctgggcacctacctctggaccgatgtctacagcgcggccccagccggggcccaaaccttcagcctgaagcactcggaacacgtgtgggtggaggtggtgcgtgatggggaggctgaggaggtggccaccaatggcaagcagcgctggcttctctcgcccagcaccaccctgcgggtcaccatgagccaggcgagcaccgaggccagcagtgacaaggtcaccgtcaactactatgacgaggaagggagcattcccatcgaccaggcggggctcttcctcacagccattgagatctccctggatgtggacgcagaccgggatggtgtggtggagaagaacaacccaaagaaggcatcctggacctggggccccgagggccagggggccatcctgctggtgaactgtgaccgagagacaccctggttgcccaaggaggactgccgtgatgagaaggtctacagcaaggaagatctcaaggacatgtcccagatgatcctgcggaccaaaggccccgaccgcctccccgccggatacgagatagttctgtacatttccatgtcagactcagacaaagtgggcgtgttctacgtggagaacccgttcttcggccaacgctatatccacatcctgggccggcggaagctctaccatgtggtcaagtacacgggtggctccgcggagctgctgttcttcgtggaaggcctctgtttccccgacgagggcttctcaggcctggtctccatccatgtcagcctgctggagtacatggcccaggacattcccctgactcccatcttcacggacaccgtgatattccggattgctccgtggatcatgacccccaacatcctgcctcccgtgtcggtgtttgtgtgctgcatgaaggataattacctgttcctgaaagaggtgaagaaccttgtggagaaaaccaactgtgagctgaaggtctgcttccagtacctaaaccgaggcgatcgctggatccaggatgaaattgagtttggctacatcgaggccccccataaaggcttccccgtggtgctggactctccccgagatggaaacctaaaggacttccctgtgaaggagctcctgggcccagattttggctacgtgacccgggagcccctctttgagtctgtcaccagccttgactcatttggaaacctggaggtcagtcccccagtgaccgtgaatggcaagacatacccgcttggccgcatcctcatcgggagcagctttcctctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein S30
- 3-oxoacyl-ACP synthase, mitochondrial
- chromosome 9 open reading frame 43
- thromboxane A synthase 1 (platelet)

Buy PADI2-peptidyl arginine deiminase, type II Gene now

Add to cart