ZC3H10-zinc finger CCCH-type containing 10 Gene View larger

ZC3H10-zinc finger CCCH-type containing 10 Gene

PTXBC018708

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZC3H10-zinc finger CCCH-type containing 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZC3H10-zinc finger CCCH-type containing 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018708
Product type: DNA & cDNA
Ncbi symbol: ZC3H10
Origin species: Human
Product name: ZC3H10-zinc finger CCCH-type containing 10 Gene
Size: 2ug
Accessions: BC018708
Gene id: 84872
Gene description: zinc finger CCCH-type containing 10
Synonyms: ZC3HDC10; zinc finger CCCH domain-containing protein 10; zinc finger CCCH-type domain containing 10; zinc finger CCCH-type containing 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgaccgggacagctatgccaacggtaccgggagcagcggtggaggccctggaggtggtggcagcgaggaggccagtggggcaggggtaggcagtggcggggccagctcagatgccatctgtagagacttcttgaggaatgtgtgcaagcgaggcaagcgttgccgatatcgccacccagacatgagcgaggtgtccaacttgggggtgagcaaaaacgagttcatcttctgccatgacttccagaacaaggagtgtagccgcccaaattgccgtttcatccatggctccaaggaggatgaggatggctataagaagacaggagagcttcccccacggctgaggcagaaagtagcagctggccttggcctttcaccggctgacctaccaaatggcaaggaggaggtccctatctgccgtgactttctcaagggtgactgtcagagaggagccaagtgcaagttccgtcacctgcaacgggattttgagtttgatgctcggggtggaggaggcactggtgggggctcaacaggctcagtcctcccaggacgacgtcatgatctctatgatatctatgaccttcctgacaggggctttgaggaccatgagccaggcccaaaacgccggcgaggtggatgctgcccccctgatggccctcattttgagtcatatgaatatagtttggctccaccgcgaggggtggagtgcagactgctagaggaggagaatgccatgctcaggaagcgggtagaggagttaaagaagcaggtcagcaacctgctggccaccaatgaggtactactggaacaaaatgctcagttccgcaatcaggccaaggtcataaccctgagctccactgcaccagcgactgagcagactctggcccccactgtgggcactgttgccacttttaaccatggcattgcccagactcacactactctcagcagccaggctctacagcctcgtccagtgtcccagcaagaactggtggcccctgctggagctccagctgctcccccaactaatgctgcacctcctgctgctccaccacccccacccccacacttgaccccagagatcacgccactgtcagctgccctggctcaaacaattgcccagggaatggcacctccacctgtctccatggctcctgtggctgtatctgtggctcctgtggcccctgtggctgtatcgatggcccaacccttggcaggaatcacaatgagccacaccaccactcccatggtgacttaccctatcgcttcccagagcatgcgcatcacggccatgccacactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peptidyl arginine deiminase, type II
- mitochondrial ribosomal protein S30
- 3-oxoacyl-ACP synthase, mitochondrial
- chromosome 9 open reading frame 43

Buy ZC3H10-zinc finger CCCH-type containing 10 Gene now

Add to cart