Login to display prices
Login to display prices
PSG3-pregnancy specific beta-1-glycoprotein 3 Gene View larger

PSG3-pregnancy specific beta-1-glycoprotein 3 Gene

PTXBC005924

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSG3-pregnancy specific beta-1-glycoprotein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PSG3-pregnancy specific beta-1-glycoprotein 3 Gene

Proteogenix catalog: PTXBC005924
Ncbi symbol: PSG3
Product name: PSG3-pregnancy specific beta-1-glycoprotein 3 Gene
Size: 2ug
Accessions: BC005924
Gene id: 5671
Gene description: pregnancy specific beta-1-glycoprotein 3
Synonyms: pregnancy-specific beta-1-glycoprotein 3; PS-beta-G-3; PSBG-3; carcinoembryonic antigen SG5; pregnancy-specific glycoprotein 3; pregnancy specific beta-1-glycoprotein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggcccctctcagcccctccctgcacacagcgcatcacctggaaggggctcctgctcacagcattacttttaaacttctggaacttgcctaccactgcccaagtcacgattgaagccgagccaaccaaagtttccaaggggaaggacgttcttctacttgtccacaatttgccccagaatcttgctggctacatctggtacaaagggcaaatgaaggacctctaccattacattacatcatacgtagtagatggtcaaataattatatatgggcctgcatacagtggacgagaaacagtatattccaatgcatccctgctgatccagaatgtcacccgggaggacgcaggatcctacaccttacacatcgtaaagcgaggtgatgggactagaggagaaactggacatttcaccttcaccttatacctggagactcccaagccctccatctccagcagcaacttataccccagggaggacatggaggctgtgagcttaacctgtgatcctgagactccggacgcaagctacctgtggtggatgaatggtcagagcctccctatgactcacagcttgcagttgtccaaaaacaaaaggaccctctttctatttggtgtcacaaagtacactgcaggaccctatgaatgtgaaatacggaacccagtgagtgccagccgcagtgacccagtcaccctgaatctcctcccgaagctgcccaagccctacatcaccatcaacaacttaaaccccagggagaataaggatgtcttagccttcacctgtgaacctaagagtgagaactacacctacatttggtggctaaatggtcagagcctcccggtcagtcccagggtaaagcgacccattgaaaacaggatcctcattctacccagtgtcacgagaaatgaaacaggaccctatcaatgtgaaatacaggaccgatatggtggcatccgcagttacccagtcaccctgaatgtcctctatggtccagacctccccagaatttacccttcattcacctattaccattcaggagaaaacctctacttgtcctgcttcgcggactctaacccaccagcagaatattcttggacaattaatgggaagtttcagctatcaggacaaaagctctttatcccccagattactacaaagcatagcgggctctatgcttgctctgttcgtaactcagccactggcatggaaagctccaaatccatgacagtcgaagtctctgctccttcaggaacaggacatcttcctggccttaatccattatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: