PSG3-pregnancy specific beta-1-glycoprotein 3 Gene View larger

PSG3-pregnancy specific beta-1-glycoprotein 3 Gene

PTXBC005924

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSG3-pregnancy specific beta-1-glycoprotein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PSG3-pregnancy specific beta-1-glycoprotein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005924
Product type: DNA & cDNA
Ncbi symbol: PSG3
Origin species: Human
Product name: PSG3-pregnancy specific beta-1-glycoprotein 3 Gene
Size: 2ug
Accessions: BC005924
Gene id: 5671
Gene description: pregnancy specific beta-1-glycoprotein 3
Synonyms: pregnancy-specific beta-1-glycoprotein 3; PS-beta-G-3; PSBG-3; carcinoembryonic antigen SG5; pregnancy-specific glycoprotein 3; pregnancy specific beta-1-glycoprotein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggcccctctcagcccctccctgcacacagcgcatcacctggaaggggctcctgctcacagcattacttttaaacttctggaacttgcctaccactgcccaagtcacgattgaagccgagccaaccaaagtttccaaggggaaggacgttcttctacttgtccacaatttgccccagaatcttgctggctacatctggtacaaagggcaaatgaaggacctctaccattacattacatcatacgtagtagatggtcaaataattatatatgggcctgcatacagtggacgagaaacagtatattccaatgcatccctgctgatccagaatgtcacccgggaggacgcaggatcctacaccttacacatcgtaaagcgaggtgatgggactagaggagaaactggacatttcaccttcaccttatacctggagactcccaagccctccatctccagcagcaacttataccccagggaggacatggaggctgtgagcttaacctgtgatcctgagactccggacgcaagctacctgtggtggatgaatggtcagagcctccctatgactcacagcttgcagttgtccaaaaacaaaaggaccctctttctatttggtgtcacaaagtacactgcaggaccctatgaatgtgaaatacggaacccagtgagtgccagccgcagtgacccagtcaccctgaatctcctcccgaagctgcccaagccctacatcaccatcaacaacttaaaccccagggagaataaggatgtcttagccttcacctgtgaacctaagagtgagaactacacctacatttggtggctaaatggtcagagcctcccggtcagtcccagggtaaagcgacccattgaaaacaggatcctcattctacccagtgtcacgagaaatgaaacaggaccctatcaatgtgaaatacaggaccgatatggtggcatccgcagttacccagtcaccctgaatgtcctctatggtccagacctccccagaatttacccttcattcacctattaccattcaggagaaaacctctacttgtcctgcttcgcggactctaacccaccagcagaatattcttggacaattaatgggaagtttcagctatcaggacaaaagctctttatcccccagattactacaaagcatagcgggctctatgcttgctctgttcgtaactcagccactggcatggaaagctccaaatccatgacagtcgaagtctctgctccttcaggaacaggacatcttcctggccttaatccattatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SPARC related modular calcium binding 1
- serine/threonine-protein kinase NIM1
- pyruvate dehydrogenase kinase, isozyme 1
- F-box and WD repeat domain containing 2

Buy PSG3-pregnancy specific beta-1-glycoprotein 3 Gene now

Add to cart