Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of AP1M1-adaptor-related protein complex 1, mu 1 subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AP1M1-adaptor-related protein complex 1, mu 1 subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017469 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AP1M1 |
| Origin species: | Human |
| Product name: | AP1M1-adaptor-related protein complex 1, mu 1 subunit Gene |
| Size: | 2ug |
| Accessions: | BC017469 |
| Gene id: | 8907 |
| Gene description: | adaptor-related protein complex 1, mu 1 subunit |
| Synonyms: | AP47; CLAPM2; CLTNM; MU-1A; AP-1 complex subunit mu-1; AP-mu chain family member mu1A; HA1 47 kDa subunit; adapter-related protein complex 1 subunit mu-1; adaptor protein complex AP-1 mu-1 subunit; adaptor protein complex AP-1 subunit mu-1; adaptor-related protein complex 1 subunit mu-1; clathrin adaptor protein AP47; clathrin assembly protein complex 1 medium chain 1; clathrin assembly protein complex 1 mu-1 medium chain 1; clathrin assembly protein complex 1, medium chain; clathrin assembly protein complex AP1, mu subunit; clathrin coat assembly protein AP47; clathrin coat-associated protein AP47; golgi adaptor AP-1 47 kDa protein; golgi adaptor HA1/AP1 adaptin mu-1 subunit; mu-adaptin 1; mu1A-adaptin; adaptor related protein complex 1 mu 1 subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccgccagcgccgtctacgtgctggacctgaagggcaaggtgctcatctgccggaactaccgtggcgacgtggacatgtcagaggtggagcacttcatgcccatcctgatggagaaggaggaggaggggatgctgtcgcccatcctggcccacgggggggtccgtttcatgtggatcaaacacaacaacctgtatctggttgccacatccaagaagaacgcgtgcgtgtcgctggtcttttctttcctctataaggtggtgcaggtgttttccgagtacttcaaggagctggaggaggagagcatccgggacaactttgttatcatctacgagctgctggacgagctcatggacttcggctacccccagaccaccgacagcaagatcctgcaggagtacatcactcaggaaggccacaagctggaaacaggggccccgcggccaccagccaccgtcaccaacgcggtgtcctggcggtccgaaggcatcaagtatcggaagaatgaggtgttcttggacgtcatcgagtctgtcaacctcttggtcagcgccaacggcaatgtcctgcgcagcgagatcgtgggctccatcaagatgcgagtcttcctctcgggcatgcccgagctgcgcctgggcctcaacgacaaggtcctctttgacaacacgggccgcggcaaaagcaaatccgtggagctggaggatgtgaagttccaccagtgtgtgcggctatcacgcttcgagaatgaccgcaccatctccttcatcccacccgacggcgagttcgagctcatgtcctaccgtctcaacacccacgtcaagcctttgatatggatcgagtcggtgatcgagaagcactcccacagccgcatcgagtacatgatcaaggccaaaagccagttcaagcggcggtcaacagccaacaacgtggagatccacattcccgtgcccaatgatgccgactcacccaagttcaagacgacggtggggagcgttaagtgggtccccgagaacagcgagattgtgtggtccatcaagtccttcccgggcggcaaggagtacctgatgcgggcccacttcggcctgcctagtgtggaggccgaagacaaggagggcaagcccccgatcagtgtcaagttcgagatcccttacttcactacctccggcatccaggtgcgctacctgaagatcattgagaagagtgggtaccaggccctgccctgggtgcgttatatcacgcagaatggagattaccagctccggacccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - adaptor-related protein complex 1, mu 2 subunit - echinoderm microtubule associated protein like 2 - family with sequence similarity 113, member B - acyl-CoA synthetase short-chain family member 2 |