EML2-echinoderm microtubule associated protein like 2 Gene View larger

EML2-echinoderm microtubule associated protein like 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EML2-echinoderm microtubule associated protein like 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EML2-echinoderm microtubule associated protein like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032630
Product type: DNA & cDNA
Ncbi symbol: EML2
Origin species: Human
Product name: EML2-echinoderm microtubule associated protein like 2 Gene
Size: 2ug
Accessions: BC032630
Gene id: 24139
Gene description: echinoderm microtubule associated protein like 2
Synonyms: EMAP-2; EMAP2; echinoderm microtubule-associated protein-like 2; echinoderm MT-associated protein (EMAP)-like protein 70; microtubule-associated protein like echinoderm EMAP; echinoderm microtubule associated protein like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtagctttggagctggcaaaaccaaagaagttatcttcagtgtggaggatggctccgtgaaaatgttcctgaggggccgccctgtgcccatgatgatcccagacgagctggcacccacctacagcctggacacacgctcggagctgccttcttgccggctcaagctggagtgggtctatggctaccgtggccgagactgccgggccaacctttatttgctgcccaccggggagatagtgtactttgtggcctccgtagccgtgctatacagcgtggaggagcagaggcagcgacactacctgggacacaacgatgacatcaaatgcttggccatccacccagatatggtcaccatcgccacgggacaggtggcgggaaccactaaggaagggaagccgctgccgccccacgtgcgcatctgggactcagtttccctctccaccttacacgtgctgggcttgggggtgtttgacagagccgtgtgctgtgtgggcttctccaaatctaatggaggcaacctgctgtgtgcagtggatgaatccaatgatcacatgctctcggtgtgggactgggccaaggagaccaaggtggtggatgtcaagtgctccaatgaggctgtattggtggccaccttccaccccacggaccccactgtgcttatcacctgcgggaaatctcacatctacttctggaccttggaggggggcagcttgagcaagcggcaaggcctctttgagaaacatgagaaaccgaagtatgtgctgtgtgtgacctttttggaaggtggcgacgtggtcacgggggactctggggggaacctctatgtttggggcaaaggtgggaaccgtatcacacaggcggtgctgggcgcccacgacggcggcgtgtttgggctctgcgccctgcgggacgggacgctggtgtctggagggggccgtgatcggcgggtggtcctctggggttctgactacagcaagctgcaggaagtggaggtccctgaggactttggccctgtgcgcaccgtggcagagggccacggagacacactgtacgtggggaccacccgcaattccatcctgcagggctccgtgcacacaggcttctcactgctggtccagggccatgtggaagagctgtggggcctggccacacaccccagtcgggcccagtttgtgacctgcgggcaggataagctggtgcatctatggagctcagattcccaccagcccctgtggagcaggatcatcgagatggctgctgctggacacggagacccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 113, member B
- acyl-CoA synthetase short-chain family member 2
- sphingomyelin phosphodiesterase, acid-like 3A
- nuclear receptor subfamily 5, group A, member 1

Buy EML2-echinoderm microtubule associated protein like 2 Gene now

Add to cart