ACSS2-acyl-CoA synthetase short-chain family member 2 Gene View larger

ACSS2-acyl-CoA synthetase short-chain family member 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACSS2-acyl-CoA synthetase short-chain family member 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACSS2-acyl-CoA synthetase short-chain family member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010141
Product type: DNA & cDNA
Ncbi symbol: ACSS2
Origin species: Human
Product name: ACSS2-acyl-CoA synthetase short-chain family member 2 Gene
Size: 2ug
Accessions: BC010141
Gene id: 55902
Gene description: acyl-CoA synthetase short-chain family member 2
Synonyms: ACAS2; ACECS; ACS; ACSA; dJ1161H23.1; acetyl-coenzyme A synthetase, cytoplasmic; acetate thiokinase; acetate-CoA ligase; acetyl-Coenzyme A synthetase 2 (ADP forming); acyl-activating enzyme; cytoplasmic acetyl-coenzyme A synthetase; acyl-CoA synthetase short-chain family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtgactccaccagccagtcccccccaattaagaggtcatgcccagatgtgcagatctcatggaaccaagggattgacttgtggtggcatgagctcatgcaagaggcaggggatgagtgtgagcccgagtggtgtgatgccgaggacccactcttcatcctgtacaccagtggctccacaggcaaacccaagggtgtggttcacacagttgggggctacatgctctatgtagccacaaccttcaagtatgtgtttgacttccatgcagaggatgtgttctggtgcacggcagacattggttggatcactggtcattcctacgtcacctatgggccactggccaatggtgccaccagtgttttgtttgaggggattcccacatatccggacgtgaaccgcctgtggagcattgtggacaaatacaaggtgaccaagttctacacagcacccacagccatccgtctgctcatgaagtttggagatgagcctgtcaccaagcatagccgggcatccttgcaggtgttaggcacagtgggtgaacccatcaaccctgaggcctggctatggtaccaccgggtggtaggtgcccagcgctgccccatcgtggacaccttctggcaaacagagacaggtggccacatgttgactccccttcctggtgccacacccatgaaacccggttctgctactttcccattctttggtgtagctcctgcaatcctgaatgagtccggggaagagttggaaggtgaagctgaaggttatctggtgttcaagcagccctggccagggatcatgcgcacagtctatgggaaccacgaacgctttgagacaacctactttaagaagtttcctggatactatgttacaggagatggctgccagcgggaccaggatggctattactggatcactggcaggattgatgacatgctcaatgtatctggacacctgctgagtacagcagaggtggagtcagcacttgtggaacatgaggctgttgcagaggcagctgtggtgggccaccctcatcctgtgaagggtgaatgcctctactgctttgtcaccttgtgtgatggccacaccttcagccccaagctcaccgaggagctcaagaagcagattagagaaaagattggccccattgccacaccagactacatccagaatgcacctggcttgcctaaaacccgctcagggaaaatcatgaggcgagtgcttcggaagattgctcagaatgaccatgacctcggggacatgtctactgtggctgacccatctgtcatcagtcacctcttcagccaccgctgcctgaccatccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sphingomyelin phosphodiesterase, acid-like 3A
- nuclear receptor subfamily 5, group A, member 1
- nuclear receptor subfamily 1, group H, member 2
- nuclear receptor subfamily 0, group B, member 1

Buy ACSS2-acyl-CoA synthetase short-chain family member 2 Gene now

Add to cart