TICAM1-toll-like receptor adaptor molecule 1 Gene View larger

TICAM1-toll-like receptor adaptor molecule 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TICAM1-toll-like receptor adaptor molecule 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TICAM1-toll-like receptor adaptor molecule 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035331
Product type: DNA & cDNA
Ncbi symbol: TICAM1
Origin species: Human
Product name: TICAM1-toll-like receptor adaptor molecule 1 Gene
Size: 2ug
Accessions: BC035331
Gene id: 148022
Gene description: toll-like receptor adaptor molecule 1
Synonyms: IIAE6; MyD88-3; PRVTIRB; TICAM-1; TRIF; TIR domain-containing adapter molecule 1; TIR domain containing adaptor inducing interferon-beta; TIR domain-containing adapter protein inducing IFN-beta; proline-rich, vinculin and TIR domain-containing protein B; toll-interleukin-1 receptor domain-containing adapter protein inducing interferon beta; toll like receptor adaptor molecule 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctgcacgggcccatcacttcctagcgccttcgacattctaggtgcagcaggccaggacaagctcttgtatctgaagcacaaactgaagaccccacgcccaggctgccaggggcaggacctcctgcatgccatggttctcctgaagctgggccaggaaactgaggccaggatctctctagaggcattgaaggccgatgcggtggcccggctggtggcccgccagtgggctggcgtggacagcaccgaggacccagaggagcccccagatgtgtcctgggctgtggcccgcttgtaccacctgctggctgaggagaagctgtgccccgcctcgctgcgggacgtggcctaccaggaagccgtccgcaccctcagctccagggacgaccaccggctgggggaacttcaggatgaggcccgaaaccggtgtgggtgggacattgctggggatccagggagcatccggacgctccagtccaatctgggctgcctcccaccatcctcggctttgccctctgggaccaggagcctcccacgccccattgacggtgtttcggactggagccaagggtgctccctgcgatccactggcagccctgcctccctggccagcaacttggaaatcagccagtcccctaccatgcccttcctcagcctgcaccgcagcccacatgggcccagcaagctctgtgacgacccccaggccagcttggtgcccgagcctgtccccggtggctgccaggagcctgaggagatgagctggccgccatcgggggagattgccagcccaccagagctgccaagcagcccacctcctgggcttcccgaagtggccccagatgcaacctccactggcctccctgatacccccgcagctccagaaaccagcaccaactacccagtggagtgcaccgaggggtctgcaggcccccagtctctccccttgcctattctggagccggtcaaaaacccctgctctgtcaaagaccagacgccactccaactttctgtagaagataccacctctccaaataccaagccgtgcccacctactcccaccaccccagaaacatcccctcctcctcctcctcctcctccttcatctactccttgttcagctcacctgaccccctcctccctgttcccttcctccctggaatcatcatcggaacagaaattctataacttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, DHHC-type containing 23
- chromosome 9 open reading frame 125
- chromosome 12 open reading frame 12
- chromosome 6 open reading frame 168

Buy TICAM1-toll-like receptor adaptor molecule 1 Gene now

Add to cart