ZDHHC23-zinc finger, DHHC-type containing 23 Gene View larger

ZDHHC23-zinc finger, DHHC-type containing 23 Gene

PTXBC035230

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZDHHC23-zinc finger, DHHC-type containing 23 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZDHHC23-zinc finger, DHHC-type containing 23 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035230
Product type: DNA & cDNA
Ncbi symbol: ZDHHC23
Origin species: Human
Product name: ZDHHC23-zinc finger, DHHC-type containing 23 Gene
Size: 2ug
Accessions: BC035230
Gene id: 254887
Gene description: zinc finger, DHHC-type containing 23
Synonyms: palmitoyltransferase ZDHHC23; DHHC-23; zinc finger DHHC domain-containing protein 23; zinc finger DHHC-type containing 23
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcctgtgaagaaaaagaaaaccgaagaacctgaattggagcccctgtgctgctgcgagtacatagatcggaatggggaaaagaaccacgtggctacttgtttgtgtgattgtcaagatctggatgaagggtgtgatcgatggattacatgtaaatctttacagccagagacttgtgaaagaatcatggatacaatttctgatcgcctccgaattccttggcttaggggagccaaaaaagtgaacatcagcatcatccctccgcttgtcctgctgcctgtcttccttcatgtggcttcctggcatttcctcctgggggtggtggttttgacctcccttcctgtgctggcactgtggtactactacctcactaacagaaggaaagaacagaccctgtttttcctgagccttggactgttctctctgggctacatgtactatgtgttcctgcaggaagtggtccccaaagggcgtgtgggtcccgttcagctggcggttcttacctgcgggttatttctgatactcttagccttgcacagagccaagaagaatccaggctacctcagcaatccagcaagcggtgacagatctctaagcagcagccagctggagtgcctgagcagaaaagggcaggagaaggccaaagggttccctggggcagacatgtcgggcagtctcaacaatcgcacaacaaaggatgaccccaagggctcttccaagatgccagctggaagccccaccaaagcgaaggaggactggtgtgccaagtgccagctggtgcgaccagcccgggcatggcgctgccggatatgtggcatctgtgtgaggagaatggatcatcattgtgtctggataaatagctgcgttggagaatcaaatcatcaagcatttatacttgcccttttgatcttcttgctcacctcggtgtatgggatcacactgaccttggacaccatttgtagagacagaagtgtcttcacagctcttttctattgtcctggagtttatgcaaattacagctcggctctgtccttcacctgcgtgtggtactctgtgatcatcacagcaggcatggcctacatcttcctgatccagctgatcaacatcagctacaatgtgactgagcgggaagtccagcaggccctccgacagaagactgggcgccggctcctctgcgggctcatcgtggacacagggttacttggatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 125
- chromosome 12 open reading frame 12
- chromosome 6 open reading frame 168
- zinc finger, DHHC-type containing 11

Buy ZDHHC23-zinc finger, DHHC-type containing 23 Gene now

Add to cart