C6orf168-chromosome 6 open reading frame 168 Gene View larger

C6orf168-chromosome 6 open reading frame 168 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C6orf168-chromosome 6 open reading frame 168 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C6orf168-chromosome 6 open reading frame 168 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004869
Product type: DNA & cDNA
Ncbi symbol: C6orf168
Origin species: Human
Product name: C6orf168-chromosome 6 open reading frame 168 Gene
Size: 2ug
Accessions: BC004869
Gene id: 84553
Gene description: chromosome 6 open reading frame 168
Synonyms: C6orf168; dJ273F20; failed axon connections homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcactggggggttggctttgcttcgtccaggccgtgcgtggtggatctgagctggaaccagagcatctccttcttcggctggtgggccgggtccgaggagcccttctccttttatggggacatcatcgctttccctttgcaggattacggtgggatcatggcagggctgggctccgatccctggtggaagaaaaccctttacttgaccgggggagctttgctggccgcagctgcgtatctgctccacgaactcctggtcattaggaaacagcaagagattgactctaaagatgctattattttgcatcagtttgcaagacctaacaatggtgttccaagtttatctcctttctgtttaaagatggaaacttatttaaggatggctgacttaccgtatcagaactattttggtggaaaactctctgctcaagggaaaatgccttggattgaatataatcatgaaaaagtttctggcacagaattcataattgactttctggaagagaagcttggagtgaatttaaacaaaaaccttggccctcatgaaagagccatctccagagcggtgaccaagatggtggaggagcacttctactggacgttagcttattgccagtgggtggacaatctcaatgagacccggaagatgctctctcttagtggtggtggtcccttcagcaacctgctgaggtgggttgtgtgccacataacgaaaggaattgtgaaacgcgagatgcacggccacggcattggccgcttctccgaggaagagatttacatgctgatggagaaggacatgcggtctttagcagggcttttgggtgataagaagtacatcatggggcccaagctttccactcttgacgccactgtctttggacacttggcacaggcaatgtggaccttaccagggacaagacccgaacggctgatcaaaggtgagctgatcaaccttgccatgtactgtgagaggataaggaggaaattttggccagagtggcaccacgatgatgacaataccatctatgagtctgaggagagcagcgaaggcagcaaaacccacaccccgctgctggattttagcttttactcaaggacagagacctttgaagatgagggagcagaaaacagtttttccagaaccccagacacagattttactggacactcactctttgattcggatgtggacatggatgactatacagaccacgaacagtgcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, DHHC-type containing 11
- zinc finger, CCHC domain containing 6
- inositol 1,3,4-triphosphate 5/6 kinase
- chromosome 16 open reading frame 70

Buy C6orf168-chromosome 6 open reading frame 168 Gene now

Add to cart