Login to display prices
Login to display prices
TFB2M-transcription factor B2, mitochondrial Gene View larger

TFB2M-transcription factor B2, mitochondrial Gene

PTXBC003383

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TFB2M-transcription factor B2, mitochondrial Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TFB2M-transcription factor B2, mitochondrial Gene

Proteogenix catalog: PTXBC003383
Ncbi symbol: TFB2M
Product name: TFB2M-transcription factor B2, mitochondrial Gene
Size: 2ug
Accessions: BC003383
Gene id: 64216
Gene description: transcription factor B2, mitochondrial
Synonyms: Hkp1; mtTFB2; dimethyladenosine transferase 2, mitochondrial; HCV NS5A-transactivated protein 5; S-adenosylmethionine-6-N', N'-adenosyl(rRNA) dimethyltransferase 2; h-mtTFB; h-mtTFB2; hTFB2M; hepatitis C virus NS5A-transactivated protein 5; mitochondrial 12S rRNA dimethylase 2; mitochondrial transcription factor B2; transcription factor B2, mitochondrial
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggatcccagtggtcgggcttcctcggcggctgaggctctccgccttggcgggcgctggtcgcttttgcattttagggtctgaagcggcgacgcgaaagcatttgccggcgaggaaccactgtgggctctctgactcctctccgcagctgtggcccgaaccggatttcaggaatccgccaaggaaggcgtctaaggccagcttagactttaagcgttacgtaaccgatcggagattggctgagaccctggcgcaaatctatttgggaaaaccaagtagacctccacacctactgctggagtgcaatccaggtcctggaatcctgactcaggcattacttgaagctggtgccaaagtggttgcgctcgaaagtgacaaaacttttattccacatttggagtccttaggaaaaaatctggatggaaaactacgagtgattcactgtgacttctttaaactagatcctagaagtggtggagtaataaaaccacctgctatgtcttctcgagggctctttaagaatttgggaatagaagcagttccttggacagcagacatccctttaaaagtagttggaatgttcccaagtagaggtgagaaaagggcactttggaaactcgcatatgacttgtattcctgtacttctatatataaatttggacgaatagaagtaaatatgtttattggtgaaaaagaattccagaaactaatggcagatcctggaaatccagacttgtatcatgtattaagtgttatctggcaattagcttgtgagattaaggttctgcacatggagccttggtcatcatttgatatatacacccggaaagggccgctggaaaacccaaagcgtagggaattattagaccaattacaacaaaagctgtatcttattcaaatgattcctcgtcaaaatttatttaccaagaacttaacacctatgaactataatatattttttcacttgttaaagcactgttttgggaggcgcagcgccactgtaatagaccacttacgttcattgactccacttgatgcgagagatatattgatgcaaataggaaaacaggaggatgagaaagtagttaacatgcaccctcaagacttcaaaacactttttgaaactatagagcgttccaaagattgtgcttataaatggctgtatgatgaaaccctggaagataggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: