ZYG11B-zyg-11 homolog B (C. elegans) Gene View larger

ZYG11B-zyg-11 homolog B (C. elegans) Gene

PTXBC029832

New product

121,50 € tax excl.

Data sheet of ZYG11B-zyg-11 homolog B (C. elegans) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZYG11B-zyg-11 homolog B (C. elegans) Gene

Proteogenix catalog: PTXBC029832
Ncbi symbol: ZYG11B
Product name: ZYG11B-zyg-11 homolog B (C. elegans) Gene
Size: 2ug
Accessions: BC029832
Gene id: 79699
Gene description: zyg-11 homolog B (C. elegans)
Synonyms: ZYG11; protein zyg-11 homolog B; zyg-11 homolog B; zyg-11 family member B, cell cycle regulator
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaaaaacaaagccagaaattttaaagcttgtggttactgggatgagaaaccaccctatgaatttgccagtgcaactggctgcaagcgcctgtgtatttaacttaaccaagcaggatcttgctgcaggaatgcctgtccgactcctggctgatgtgacccatttgctgctcaaagccatggaacattttcccaatcaccagcagttacagaagaattgcctcctttcactttgcagtgaccggatccttcaagatgttccatttaacaggtttgaagcagccaagcttgtcatgcagtggctttgcaaccatgaggatcaaaacatgcaaaggatggcagttgctatcatttctatcctggctgccaagctttctacagaacaaactgcacagcttggtactgagctcttcattgtcaggcaacttcttcaaatagtgaagcagaaaaccaatcaaaattcagtggacactacattgaaatttactttgagtgcactttggaacctcacagatgaatctccaaccacttgtagacactttattgaaaaccaagggttagaactcttcatgagggttctagagtctttcccaactgagtcatccattcagcagaaagttctaggacttttgaacaatatagctgaagtacaagaattacattctgaattaatgtggaaagattttatagaccacatcagtagtctcctacacagtgtggaagtggaagtcagttactttgcagctggaattattgcccatttaatatccagaggtgaacaagcttggacattgagtcgtagccagaggaattctctgctggatgatttgcattcagctattttgaaatggccaactccagagtgtgagatggtagcatacaggtcctttaatccatttttcccattacttggctgtttcacaacaccaggagttcagctatgggcagtttgggccatgcaacatgtctgcagcaagaatccttcaaggtattgcagcatgctgattgaagaaggaggattgcagcatttatacaacatcaaagatcatgaacatactgatccccatgtccaacagattgctgtggccattctggatagcttagaaaaacacattgtgcgccatgggaggccacctccctgtaaaaaacagccccaagccagactaaattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

Buy ZYG11B-zyg-11 homolog B (C. elegans) Gene now

Add to cart