DUSP4-dual specificity phosphatase 4 Gene View larger

DUSP4-dual specificity phosphatase 4 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DUSP4-dual specificity phosphatase 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DUSP4-dual specificity phosphatase 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002671
Product type: DNA & cDNA
Ncbi symbol: DUSP4
Origin species: Human
Product name: DUSP4-dual specificity phosphatase 4 Gene
Size: 2ug
Accessions: BC002671
Gene id: 1846
Gene description: dual specificity phosphatase 4
Synonyms: HVH2; MKP-2; MKP2; TYP; dual specificity protein phosphatase 4; MAP kinase phosphatase 2; VH1 homologous phosphatase 2; dual specificity protein phosphatase hVH2; mitogen-activated protein kinase phosphatase 2; serine/threonine specific protein phosphatase; dual specificity phosphatase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgacgatggaggagctgcgggagatggactgcagtgtgctcaaaaggctgatgaaccgggacgagaatggcggcggcgcgggcggcagcggcagccacggcaccctggggctgccgagcggcggcaagtgcctgctgctggactgcagaccgttcctggcgcacagcgcgggctacatcctaggttcggtcaacgtgcgctgtaacaccatcgtgcggcggcgggctaagggctccgtgagcctggagcagatcctgcccgccgaggaggaggtacgcgcccgcttgcgctccggcctctactcggcggtcatcgtctacgacgagcgcagcccgcgcgccgagagcctccgcgaggacagcaccgtgtcgctggtggtgcaggcgctgcgccgcaacgccgagcgcaccgacatctgcctgctcaaaggcggctatgagaggttttcctccgagtacccagaattctgttctaaaaccaaggccctggcagccatcccacccccggttccccccagcgccacagagcccttggacctgggctgcagctcctgtgggaccccactacacgaccaggggggtcctgtggagatccttcccttcctctacctcggcagtgcctaccatgctgcccggagagacatgctggacgccctgggcatcacggctctgttgaatgtctcctcggactgcccaaaccactttgaaggacactatcagtacaagtgcatcccagtggaagataaccacaaggccgacatcagctcctggttcatggaagccatagagtacatcgatgccgtgaaggactgccgtgggcgcgtgctggtgcactgccaggcgggcatctcgcggtcggccaccatctgcctggcctacctgatgatgaagaaacgggtgaggctggaggaggccttcgagttcgttaagcagcgccgcagcatcatctcgcccaacttcagcttcatggggcagctgctgcagttcgagtcccaggtgctggccacgtcctgtgctgcggaggctgctagcccctcgggacccctgcgggagcggggcaagacccccgccacccccacctcgcagttcgtcttcagctttccggtctccgtgggcgtgcactcggcccccagcagcctgccctacctgcacagccccatcaccacctctcccagctgttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine rich repeat neuronal 4
- STAM binding protein-like 1
- DBF4 homolog B (S. cerevisiae)
- trans-golgi network protein 2

Buy DUSP4-dual specificity phosphatase 4 Gene now

Add to cart