LRRN4-leucine rich repeat neuronal 4 Gene View larger

LRRN4-leucine rich repeat neuronal 4 Gene

PTXBC019612

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LRRN4-leucine rich repeat neuronal 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LRRN4-leucine rich repeat neuronal 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019612
Product type: DNA & cDNA
Ncbi symbol: LRRN4
Origin species: Human
Product name: LRRN4-leucine rich repeat neuronal 4 Gene
Size: 2ug
Accessions: BC019612
Gene id: 164312
Gene description: leucine rich repeat neuronal 4
Synonyms: C20orf75; NLRR-4; NLRR4; dJ1056H1.1; leucine-rich repeat neuronal protein 4; neuronal leucine-rich repeat protein 4; leucine rich repeat neuronal 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgcgcgccagctgcgggatccagcggccccttctcagcctccctgtcactctcccagctgcccggagtgtgccagtccgaccaaagcaccactctcggggcttcacacccaccttgcttcaaccgctccacctacgcacagggtaccaccgtcgcgcccagcgcagcccccgccacccggcctgcgggagaccagcagagtgtctccaaggcccctaacgtgggctctcgcacgatagctgcatggccgcacagcgatgcacgggaggggactgccccctccacgaccaactctgtagcaggtcacagcaactccagcgttttccccagggctgccagcaccaccaggacccagcaccgaggagaacatgcccccgagcttgtccttgagcctgatatctcagctgcctccaccccactggccagcaagctcctgggccccttccctacctcgtgggaccgcagcataagctcgcctcagcccggccagaggacacacgccacaccccaagcccccaacccgagtctttccgagggcgagattccagtcttgctgctggacgactacagtgaggaggaggaagggaggaaggaggaggtgggaacgcctcaccaggacgtcccctgtgattaccatccctgcaagcacctgcagaccccgtgcgcggagctgcagaggcggtggcggtgccggtgccccggcctcagcggggaagacaccatcccagacccgcccaggctgcagggggtgacggagaccacggacacgtcggcgctggtccactggtgtgcccccaactcggtagtgcatgggtaccagatccgctactctgcggagggctgggcggggaaccagtcggtggtgggggtcatctacgccacggcccggcagcaccctctgtacgggctgtcgccgggcaccacctaccgcgtgtgcgtgctggcggccaacagggcgggcttgagccagccacggtcttcgggctggaggagcccgtgcgccgccttcaccaccaagcccagcttcgcgctcctgctctctgggctgtgcgccgccagcggcctgttgctcgccagcaccgtggtgctgtccgcatgtctctgcaggcggggccagacgctgggcctgcagcgctgcgacacgcacctggtggcctacaaaaacccggcctttgatgattacccgctggggctccagaccgtcagttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - STAM binding protein-like 1
- DBF4 homolog B (S. cerevisiae)
- trans-golgi network protein 2
- integrator complex subunit 12

Buy LRRN4-leucine rich repeat neuronal 4 Gene now

Add to cart