FCRLA-Fc receptor-like A Gene View larger

FCRLA-Fc receptor-like A Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FCRLA-Fc receptor-like A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FCRLA-Fc receptor-like A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006521
Product type: DNA & cDNA
Ncbi symbol: FCRLA
Origin species: Human
Product name: FCRLA-Fc receptor-like A Gene
Size: 2ug
Accessions: BC006521
Gene id: 84824
Gene description: Fc receptor-like A
Synonyms: FCRL; FCRL1; FCRLM1; FCRLX; FCRLb; FCRLc1; FCRLc2; FCRLd; FCRLe; FCRX; FREB; Fc receptor-like A; Fc receptor homolog expressed in B cells (FREB); Fc receptor related protein X; Fc receptor-like and mucin-like 1; fc receptor homolog expressed in B-cells; fc receptor-like and mucin-like protein 1; fc receptor-like protein; fc receptor-related protein X; Fc receptor like A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctgggctgtgtcctcatggcctgggccctctacctttcccttggtgtgctctgggtggcccagatgctactggctgccagttttgagacgctgcagtgtgagggacctgtctgcactgaggagagcagctgccacacggaggatgacttgactgatgcaagggaagctggcttccaggtcaaggcctacactttcagtgaacccttccacctgattgtgtcctatgactggctgatcctccaaggtccagccaagccagtttttgaaggggacctgctggttctgcgctgccaggcctggcaagactggccactgactcaggtgaccttctaccgagatggctcagctctgggtccccccgggcctaacagggaattctccatcaccgtggtacaaaaggcagacagcgggcactaccactgcagtggcatcttccagagccctggtcctgggatcccagaaacagcatctgttgtggctatcacagtccaagaactgtttccagcgccaattctcagagctgtaccctcagctgaaccccaagcaggaagccccatgaccctgagttgtcagacaaagttgcccctgcagaggtcagctgcccgcctcctcttctccttctacaaggatggaaggatagtgcaaagcagggggctctcctcagaattccagatccccacagcttcagaagatcactccgggtcatactggtgtgaggcagccactgaggacaaccaagtttggaaacagagcccccagctagagatcagagtgcagggtgcttccagctctgctgcacctcccacattgaatccagctcctcagaaatcagctgctccaggaactgctcctgaggaggcccctgggcctctgcctccgccgccaaccccatcttctgaggatccaggcttttcttctcctctggggatgccagatcctcatctgtatcaccagatgggccttcttctcaaacacatgcaggatgtgagagtcctcctcggtcacctgctcatggagttgagggaattatctggccaccagaagcctgggaccacaaaggctactgctgaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ERGIC and golgi 2
- selectin P ligand
- galactosidase, alpha
- Fc receptor-like 1

Buy FCRLA-Fc receptor-like A Gene now

Add to cart