FCRL1-Fc receptor-like 1 Gene View larger

FCRL1-Fc receptor-like 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FCRL1-Fc receptor-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FCRL1-Fc receptor-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033690
Product type: DNA & cDNA
Ncbi symbol: FCRL1
Origin species: Human
Product name: FCRL1-Fc receptor-like 1 Gene
Size: 2ug
Accessions: BC033690
Gene id: 115350
Gene description: Fc receptor-like 1
Synonyms: CD307a; FCRH1; IFGP1; IRTA5; Fc receptor-like protein 1; IFGP family protein 1; fc receptor homolog 1; fcR-like protein 1; hIFGP1; immune receptor translocation-associated protein 5; immunoglobulin superfamily Fc receptor, gp42; Fc receptor like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgccgaggctgttgctgttgatctgtgctccactctgtgaacctgccgagctgtttttgatagccagcccctcccatcccacagaggggagcccagtgaccctgacgtgtaagatgccctttctacagagttcagatgcccagttccagttctgctttttcagagacacccgggccttgggcccaggctggagcagctcccccaagctccagatcgctgccatgtggaaagaagacacagggtcatactggtgcgaggcacagacaatggcgtccaaagtcttgaggagcaggagatcccagataaatgtgcacagggtccctgtcgctgatgtgagcttggagactcagcccccaggaggacaggtgatggagggagacaggctggtcctcatctgctcagttgctatgggcacaggagacatcaccttcctttggtacaaaggggctgtaggtttaaaccttcagtcaaagacccagcgttcactgacagcagagtatgagattccttcagtgagggagagtgatgctgagcaatattactgtgtagctgaaaatggctatggtcccagccccagtgggctggtgagcatcactgtcagaatcccggtgtctcgcccaatcctcatgctcagggctcccagggcccaggctgcagtggaggatgtgctggagcttcactgtgaggccctgagaggctctcctccgatcctgtactggttttatcacgaggatatcaccctggggagcaggtcggccccctctggaggaggagcctccttcaacctttccctgactgaagaacattctggaaactactcctgtgaggccaacaatggcctgggggcccagcgcagtgaggcggtgacactcaacttcacagtgcctactggggccagaagcaatcatcttacctcaggagtcattgaggggctgctcagcacccttggtccagccaccgtggccttattattttgctacggcctcaaaagaaaaataggaagacgttcagccagggatccactcaggagccttcccagccctctaccccaagagttcacctacctcaactcacctaccccagggcagctacagcctatatatgaaaatgtgaatgttgtaagtggggatgaggtttattcactggcgtactataaccagccggagcaggaatcagtagcagcagaaaccctggggacacatatggaggacaaggtttccttagacatctattccaggctgaggaaagcaaacattacagatgtggactatgaagatgctatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carboxypeptidase A6
- fatty acid synthase
- tubulin, alpha 1c
- tubulin, alpha 1a

Buy FCRL1-Fc receptor-like 1 Gene now

Add to cart