SELPLG-selectin P ligand Gene View larger

SELPLG-selectin P ligand Gene

PTXBC029782

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SELPLG-selectin P ligand Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SELPLG-selectin P ligand Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029782
Product type: DNA & cDNA
Ncbi symbol: SELPLG
Origin species: Human
Product name: SELPLG-selectin P ligand Gene
Size: 2ug
Accessions: BC029782
Gene id: 6404
Gene description: selectin P ligand
Synonyms: CD162; CLA; PSGL-1; PSGL1; P-selectin glycoprotein ligand 1; cutaneous lymphocyte-associated associated antigen; selectin P ligand
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctctgcaactcctcctgttgctgatcctactgggccctggcaacagcttgcagctgtgggacacctgggcagatgaagccgagaaagccttgggtcccctgcttgcccgggaccggagacaggccaccgaatatgagtacctagattatgatttcctgccagaaacggagcctccagaaatgctgaggaacagcactgacaccactcctctgactgggcctggaacccctgagtctaccactgtggagcctgctgcaaggcgttctactggcctggatgcaggaggggcagtcacagagctgaccacggagctggccaacatggggaacctgtccacggattcagcagctatggagatacagaccactcaaccagcagccacggaggcacagaccactccactggcagccacagaggcacagacaactcgactgacggccacggaggcacagaccactccactggcagccacagaggcacagaccactccaccagcagccacggaagcacagaccactcaacccacaggcctggaggcacagaccactgcaccagcagccatggaggcacagaccactgcaccagcagccatggaagcacagaccactccaccagcagccatggaggcacagaccactcaaaccacagccatggaggcacagaccactgcaccagaagccacggaggcacagaccactcaacccacagccacggaggcacagaccactccactggcagccatggaggccctgtccacagaacccagtgccacagaggccctgtccatggaacctactaccaaaagaggtctgttcatacccttttctgtgtcctctgttactcacaagggcattcccatggcagccagcaatttgtccgtcaactacccagtgggggccccagaccacatctctgtgaagcagtgcctgctggccatcctaatcttggcgctggtggccactatcttcttcgtgtgcactgtggtgctggcggtccgcctctcccgcaagggccacatgtaccccgtgcgtaattactcccccaccgagatggtctgcatctcatccctgttgcctgatgggggtgaggggccctctgccacagccaatgggggcctgtccaaggccaagagcccgggcctgacgccagagcccagggaggaccgtgagggggatgacctcaccctgcacagcttcctcccttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - galactosidase, alpha
- Fc receptor-like 1
- carboxypeptidase A6
- fatty acid synthase

Buy SELPLG-selectin P ligand Gene now

Add to cart