C19orf47-chromosome 19 open reading frame 47 Gene View larger

C19orf47-chromosome 19 open reading frame 47 Gene

PTXBC027935

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C19orf47-chromosome 19 open reading frame 47 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C19orf47-chromosome 19 open reading frame 47 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027935
Product type: DNA & cDNA
Ncbi symbol: C19orf47
Origin species: Human
Product name: C19orf47-chromosome 19 open reading frame 47 Gene
Size: 2ug
Accessions: BC027935
Gene id: 126526
Gene description: chromosome 19 open reading frame 47
Synonyms: uncharacterized protein C19orf47; chromosome 19 open reading frame 47
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttgtggataataggattcagaagagcatgctgctggatctcaataaggagataatgaatgagctgggcgtgaccgtggtgggtgacatcatcgccattctcaagcatgccaaagtggtgcaccgtcaggacatgtgcaaagctgccactgagtcagtaccctgcagccctagcccccttgcaggcgaaattcgccgtggcaccagtgctgcctcccgaatgatcaccaacagcctgaaccatgactctccacccagcacaccccccaggcgcccggacaccagcacctccaagatctcggtcactgtgtccaacaagatggcagcaaagagtgccaaggccactgcagccctggcccgccgggaggaggagagcctggctgttcctgccaagcggcgccgggtcactgctgagatggaggggaagtacgtcatcaacatgcccaaaggcaccacaccccgcacccgcaagatcctggagcagcagcaggctgcaaaaggtctccataggacgtctgtgtttgaccgcctcggcgccgagaccaaggcagacaccacgacagggagtaaacccacaggagtcttcagccgcctgggggccaccccagaaacggacgaggatctggcttgggacagcgacaatgacagcagcagctctgtcttgcagtatgccggggtcctgaagaagctaggacggggcccagccaaggccagtccccagccagcactgactgtcaaagccaaggccacaagctcagcgacaacggctgctgccccgacactgcggcgcctggcgctttcctcacggtctgggcttgagaggaagccggagtccttgtctaaagtcagcatcatcaagagactgggcgcagctgcccttgtgcccgaggcccaggacagccaggtcaccagcaccaagagtaagtcctcagccgaggtcaaggtcaccattaagaggactctggtggggccccgggggagcagctccagcgagggccttggtgcccagatggaccacgcgggcactgtgagcgtgttcaaaagactgggccgcaggaccttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 14 open reading frame 94
- chromosome 1 open reading frame 156
- chromosome 1 open reading frame 114
- chromosome 18 open reading frame 54

Buy C19orf47-chromosome 19 open reading frame 47 Gene now

Add to cart