Login to display prices
Login to display prices
C1orf114-chromosome 1 open reading frame 114 Gene View larger

C1orf114-chromosome 1 open reading frame 114 Gene

PTXBC026073

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf114-chromosome 1 open reading frame 114 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf114-chromosome 1 open reading frame 114 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026073
Product type: DNA & cDNA
Ncbi symbol: C1orf114
Origin species: Human
Product name: C1orf114-chromosome 1 open reading frame 114 Gene
Size: 2ug
Accessions: BC026073
Gene id: 57821
Gene description: chromosome 1 open reading frame 114
Synonyms: C1orf114; coiled-coil domain-containing protein 181; coiled-coil domain containing 181
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatgaaaataaagatactgattcaaagaaaagtgaagaatacgaagatgactttgaaaaggacctggagtggttaattaatgaaaatgaaaaaagtgatgccagcataatagagatggcttgtgagaaggaagagaatattaaccaagacttaaaagagaatgagacagtaatggagcacaccaaacggcattctgatcctgacaaatctttgcaggatgaggtctcaccaagaagaaatgacatcatttctgtaccaggtattcaacctttggatcccatatcagattcagatagtgaaaactctttccaggaatccaaactagaaagccagaaagacttggaggaggaagaggatgaggaagtaaggagatatattatggagaaaattgtacaagctaacaagcttctacagaatcaagaaccggtgaatgataaaagggagcgaaaacttaagttcaaggaccagttagttgatttggaagttcctccactagaagacactactacttctaaaaattattttgaaaacgaaaggaatatgtttgggaaactgtcacaattatgtatttccaatgattttggacaagaagatgtgctcctgtcacttactaatggaagctgtgaagaaaacaaggataggacaatactggtagagagagatggaaaatttgaacttctgaatttacaagacattgccagtcaggggtttttgcctcccattaataatgcaaatagtacagaaaatgaccctcagcagttgttacccagatcttccaactcctctgtcagtggcaccaagaaagaagattctacagcaaagattcatgctgtcactcactcatcaacaggagagccgctggcttatatcgctcagccaccactcaaccgcaagacttgtccaagctctgctgtcaactcagatcgaagtaaagggaatgggaaatctaatcacaggacacagtctgcacatatctcaccagtgacttcaacatactgtctttcccctcgacagaaagaactacaaaaacaactagaagaaaagagagaaaaactgaaaagagaggaagagcgacgaaaaatagaagaagagaaagaaaaaaaagagagagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 18 open reading frame 54
- zinc finger, DHHC-type containing 16
- chromosome 17 open reading frame 46
- transcription factor B2, mitochondrial