C14orf94-chromosome 14 open reading frame 94 Gene View larger

C14orf94-chromosome 14 open reading frame 94 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C14orf94-chromosome 14 open reading frame 94 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C14orf94-chromosome 14 open reading frame 94 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001916
Product type: DNA & cDNA
Ncbi symbol: C14orf94
Origin species: Human
Product name: C14orf94-chromosome 14 open reading frame 94 Gene
Size: 2ug
Accessions: BC001916
Gene id: 54930
Gene description: chromosome 14 open reading frame 94
Synonyms: C14orf94; HAUS augmin-like complex subunit 4; homologous to Augmin subunits; HAUS augmin like complex subunit 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcatccggggatttctgctcacctggagaagggatggaaatacttcaacaagtgtgcagcaaacaacttcctccttgtaacctgagtaaagaggacctgttacagaacccatacttcagcaagcttctcctgaatctctcacagcatgtggatgagagtggcttaagcctcaccctagcaaaggagcaggctcaggcatggaaggaagttcgactgcataagacaacatggttgaggtctgagattttacacagagtcattcaagagttgcttgtggactactatgtgaagatacaagacacaaatgtaacttctgaggacaaaaagtttcatgagacccttgaacagcggctgcttgtaactgaactgatgcggctcttaggtcctagccaggagagggagatacctccactgctggggctggagaaagcggaccttctggaactcatgccactctcagaggattttgtgtggatgagggctcggctacagcaagaagtagaggagcagctcaaaaagaaatgtttcactctgctctgctactatgatcccaattcagatgctgacagtgaaaccgtgaaggcagcaaaggtgtggaaactcgcagaggtcctggtgggtgagcagcagcagtgccaggatgccaagagccagcagaaggagcagatgttgctgctggagaagaagagtgctgcttactcccaggtgcttctccgctgcctcactttgctgcagaggcttcttcaagaacaccggctgaagactcaatccgagctagaccgcatcaatgcccagtacctggaagtcaagtgcggtgctatgatccttaagctgaggatggaggagctaaagattttgtccgacacttacactgttgagaaagtggaagttcatcgtctgattagggaccgtttggagggagccattcacctacaggagcaggacatggagaactcaagacaggtcctgaactcctatgaggtccttggggaggagtttgacaggctggtgaaagagtacaccgtactcaagcaggcaacagagaacaagcggtgggccctccaggagttcagcaaggtctaccgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 156
- chromosome 1 open reading frame 114
- chromosome 18 open reading frame 54
- zinc finger, DHHC-type containing 16

Buy C14orf94-chromosome 14 open reading frame 94 Gene now

Add to cart