Login to display prices
Login to display prices
C14orf94-chromosome 14 open reading frame 94 Gene View larger

C14orf94-chromosome 14 open reading frame 94 Gene

PTXBC001916

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C14orf94-chromosome 14 open reading frame 94 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C14orf94-chromosome 14 open reading frame 94 Gene

Proteogenix catalog: PTXBC001916
Ncbi symbol: C14orf94
Product name: C14orf94-chromosome 14 open reading frame 94 Gene
Size: 2ug
Accessions: BC001916
Gene id: 54930
Gene description: chromosome 14 open reading frame 94
Synonyms: C14orf94; HAUS augmin-like complex subunit 4; homologous to Augmin subunits; HAUS augmin like complex subunit 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcatccggggatttctgctcacctggagaagggatggaaatacttcaacaagtgtgcagcaaacaacttcctccttgtaacctgagtaaagaggacctgttacagaacccatacttcagcaagcttctcctgaatctctcacagcatgtggatgagagtggcttaagcctcaccctagcaaaggagcaggctcaggcatggaaggaagttcgactgcataagacaacatggttgaggtctgagattttacacagagtcattcaagagttgcttgtggactactatgtgaagatacaagacacaaatgtaacttctgaggacaaaaagtttcatgagacccttgaacagcggctgcttgtaactgaactgatgcggctcttaggtcctagccaggagagggagatacctccactgctggggctggagaaagcggaccttctggaactcatgccactctcagaggattttgtgtggatgagggctcggctacagcaagaagtagaggagcagctcaaaaagaaatgtttcactctgctctgctactatgatcccaattcagatgctgacagtgaaaccgtgaaggcagcaaaggtgtggaaactcgcagaggtcctggtgggtgagcagcagcagtgccaggatgccaagagccagcagaaggagcagatgttgctgctggagaagaagagtgctgcttactcccaggtgcttctccgctgcctcactttgctgcagaggcttcttcaagaacaccggctgaagactcaatccgagctagaccgcatcaatgcccagtacctggaagtcaagtgcggtgctatgatccttaagctgaggatggaggagctaaagattttgtccgacacttacactgttgagaaagtggaagttcatcgtctgattagggaccgtttggagggagccattcacctacaggagcaggacatggagaactcaagacaggtcctgaactcctatgaggtccttggggaggagtttgacaggctggtgaaagagtacaccgtactcaagcaggcaacagagaacaagcggtgggccctccaggagttcagcaaggtctaccgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: