PDLIM2-PDZ and LIM domain 2 (mystique) Gene View larger

PDLIM2-PDZ and LIM domain 2 (mystique) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDLIM2-PDZ and LIM domain 2 (mystique) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PDLIM2-PDZ and LIM domain 2 (mystique) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021556
Product type: DNA & cDNA
Ncbi symbol: PDLIM2
Origin species: Human
Product name: PDLIM2-PDZ and LIM domain 2 (mystique) Gene
Size: 2ug
Accessions: BC021556
Gene id: 64236
Gene description: PDZ and LIM domain 2 (mystique)
Synonyms: MYSTIQUE; SLIM; PDZ and LIM domain protein 2; PDZ and LIM domain 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgttgacggtggatgtggccgggccagcgccctggggcttccgtatcacagggggcagggatttccacacgcccatcatggtgactaaggtggccgagcggggcaaagccaaggacgctgacctccggcctggagacataatcgtggccatcaacggggaaagcgcggagggcatgctgcatgccgaggcccagagcaagatccgccagagcccctcgcccctgcggctgcagctggaccggtctcaggctacgtctccagggcagaccaatggggacagctccttggaagtgctggcgactcgcttccagggctccgtgaggacatacactgagagtcagtcctccttaaggtcctcctactccagcccaacctccctcagcccgagggccggcagccccttctcaccaccaccctctagcagctccctcactggagaggcagccatcagccgcagcttccagagtctggcatgttccccgggcctccccgctgctgaccgcctgtcctactcaggccgccctggaagccgacaggccggcctcggccgcgctggcgactcggcggtgctggtgctgccgccttccccgggccctcgttcctccaggcccagcatggactcggaagggggaagcctcctcctggacgaggactcggaagtcttcaagatgctgcaggaaaatcgcgagggacgggcggccccccgacagtccagctcctttcggctcttgcaggaagccctggaggctgaggagagaggtggcacgccagccttcttgcccagctcactgagcccccagtcctccctgcccgcctccagggccctggccacccctcccaagctccacacttgtgagaagtgcagtaccagcatcgcgaaccaggctgtgcgcatccaggagggccggtaccgccaccccggctgctacacctgtgccgactgtgggctgaacctgaagatgcgcgggcacttctgggtgggtgacgagctgtactgtgagaagcatgcccgccagcgctactccgcacctgccaccctcagctctcgggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - blood vessel epicardial substance
- RAD23 homolog A (S. cerevisiae)
- lysophosphatidic acid receptor 1
- phosphoserine aminotransferase 1

Buy PDLIM2-PDZ and LIM domain 2 (mystique) Gene now

Add to cart