Login to display prices
Login to display prices
PSAT1-phosphoserine aminotransferase 1 Gene View larger

PSAT1-phosphoserine aminotransferase 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSAT1-phosphoserine aminotransferase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PSAT1-phosphoserine aminotransferase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016645
Product type: DNA & cDNA
Ncbi symbol: PSAT1
Origin species: Human
Product name: PSAT1-phosphoserine aminotransferase 1 Gene
Size: 2ug
Accessions: BC016645
Gene id: 29968
Gene description: phosphoserine aminotransferase 1
Synonyms: EPIP; NLS2; PSA; PSAT; PSATD; phosphoserine aminotransferase; endometrial progesterone-induced protein; phosphohydroxythreonine aminotransferase; phosphoserine aminotransferase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgcccccaggcaggtggtcaactttgggcctggtcccgccaagctgccgcactcagtgttgttagagatacaaaaggaattattagactacaaaggagttggcattagtgttgttgaaatgagtcacaggtcatcagattttgccaagattattaacaatacagagaatcttgtgcgggaattgctagctgttccagacaactataaggtgatttttctgcaaggaggtgggtgcggccagttcagtgctgtccccttaaacctcattggcttgaaagcaggaaggtgtgctgactatgtggtgacaggagcttggtcagctaaggccgcagaagaagccaagaagtttgggactataaatatcgttcaccctaaacttgggagttatacaaaaattccagatccaagcacctggaacctcaacccagatgcctcctacgtgtattattgcgcaaatgagacggtgcatggtgtggagtttgactttatacccgatgtcaagggagcagtactggtttgtgacatgtcctcaaacttcctgtccaagccagtggatgtttccaagtttggtgtgatttttgctggtgcccagaagaatgttggctctgctggggtcaccgtggtgattgtccgtgatgacctgctggggtttgccctccgagagtgcccctcggtcctggaatacaaggtgcaggctggaaacagctccttgtacaacacgcctccatgtttcagcatctacgtcatgggcttggttctggagtggattaaaaacaatggaggtgccgcggccatggagaagcttagctccatcaaatctcaaacaatttatgagattattgataattctcaaggattctacgtttgtccagtggagccccaaaatagaagcaagatgaatattccattccgcattggcaatgccaaaggagatgatgctttagaaaaaagatttcttgataaagctcttgaactcaatatgttgtccttgaaagggcataggtctgtgggaggcatccgggcctctctgtataatgctgtcacaattgaagacgttcagaagctggccgccttcatgaaaaaatttttggagatgcatcagctatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cell division cycle associated 7
- leucine rich repeat containing 2
- peroxisomal biogenesis factor 14
- SERPINE1 mRNA binding protein 1